Incidental Mutation 'R6263:Fmo1'
ID506793
Institutional Source Beutler Lab
Gene Symbol Fmo1
Ensembl Gene ENSMUSG00000040181
Gene Nameflavin containing monooxygenase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location162829561-162866610 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 162850060 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046049] [ENSMUST00000111518] [ENSMUST00000131058] [ENSMUST00000134098] [ENSMUST00000193078]
Predicted Effect probably null
Transcript: ENSMUST00000046049
SMART Domains Protein: ENSMUSP00000037259
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 1.5e-279 PFAM
Pfam:Pyr_redox_2 3 228 3.8e-13 PFAM
Pfam:NAD_binding_8 7 63 8e-7 PFAM
Pfam:K_oxygenase 73 226 3.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111518
SMART Domains Protein: ENSMUSP00000107143
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 170 4.6e-93 PFAM
Pfam:Pyr_redox_3 6 173 2.7e-8 PFAM
Pfam:NAD_binding_8 7 65 5.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131058
SMART Domains Protein: ENSMUSP00000118534
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 209 9.3e-122 PFAM
Pfam:Pyr_redox_2 4 208 8.2e-9 PFAM
Pfam:Pyr_redox_3 6 209 7.5e-16 PFAM
Pfam:NAD_binding_8 7 65 5.2e-8 PFAM
Pfam:K_oxygenase 72 209 1.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134098
SMART Domains Protein: ENSMUSP00000117398
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 303 1.4e-168 PFAM
Pfam:Pyr_redox_2 4 280 8e-9 PFAM
Pfam:Pyr_redox_3 6 220 5.5e-16 PFAM
Pfam:NAD_binding_8 7 65 9.5e-8 PFAM
Pfam:K_oxygenase 72 224 2.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193078
SMART Domains Protein: ENSMUSP00000141210
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 230 9.4e-132 PFAM
Pfam:Pyr_redox_2 4 223 4.9e-7 PFAM
Pfam:Pyr_redox_3 6 220 3.1e-14 PFAM
Pfam:NAD_binding_8 7 65 6.9e-6 PFAM
Pfam:K_oxygenase 72 222 3.8e-8 PFAM
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Fmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Fmo1 APN 1 162836246 missense probably damaging 1.00
IGL00479:Fmo1 APN 1 162830063 missense probably benign 0.00
IGL01612:Fmo1 APN 1 162833599 missense probably benign 0.42
IGL01650:Fmo1 APN 1 162833584 missense probably benign 0.04
IGL02052:Fmo1 APN 1 162850060 critical splice donor site probably null
IGL02340:Fmo1 APN 1 162832990 missense probably benign 0.02
IGL03348:Fmo1 APN 1 162850151 missense possibly damaging 0.76
IGL03388:Fmo1 APN 1 162836147 missense probably benign 0.17
PIT1430001:Fmo1 UTSW 1 162830053 missense probably benign 0.00
R0279:Fmo1 UTSW 1 162830272 missense possibly damaging 0.92
R0314:Fmo1 UTSW 1 162859462 missense probably damaging 1.00
R0348:Fmo1 UTSW 1 162836135 missense probably benign 0.00
R0385:Fmo1 UTSW 1 162836204 missense possibly damaging 0.94
R0699:Fmo1 UTSW 1 162833772 missense probably benign 0.00
R1413:Fmo1 UTSW 1 162833862 missense probably damaging 0.98
R1424:Fmo1 UTSW 1 162830066 missense probably damaging 1.00
R1430:Fmo1 UTSW 1 162839724 missense probably damaging 1.00
R1851:Fmo1 UTSW 1 162829985 nonsense probably null
R1929:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R1982:Fmo1 UTSW 1 162839756 missense possibly damaging 0.83
R2272:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R2568:Fmo1 UTSW 1 162836259 missense probably benign 0.00
R3787:Fmo1 UTSW 1 162830014 missense possibly damaging 0.54
R3825:Fmo1 UTSW 1 162851347 splice site probably benign
R3904:Fmo1 UTSW 1 162833768 missense possibly damaging 0.54
R4320:Fmo1 UTSW 1 162833631 missense probably damaging 1.00
R4367:Fmo1 UTSW 1 162833648 nonsense probably null
R4431:Fmo1 UTSW 1 162833712 missense possibly damaging 0.76
R4473:Fmo1 UTSW 1 162850163 missense possibly damaging 0.90
R5340:Fmo1 UTSW 1 162829982 missense probably benign 0.39
R5354:Fmo1 UTSW 1 162830145 missense probably benign 0.01
R5479:Fmo1 UTSW 1 162850224 missense probably damaging 0.99
R5930:Fmo1 UTSW 1 162839616 critical splice donor site probably null
R6148:Fmo1 UTSW 1 162851519 missense probably damaging 0.99
R6160:Fmo1 UTSW 1 162836298 missense probably benign 0.00
R6164:Fmo1 UTSW 1 162851410 missense probably benign 0.24
R7046:Fmo1 UTSW 1 162839694 missense possibly damaging 0.92
R7590:Fmo1 UTSW 1 162859682 intron probably benign
R7663:Fmo1 UTSW 1 162836297 missense possibly damaging 0.74
R7692:Fmo1 UTSW 1 162833833 missense probably benign 0.16
R7712:Fmo1 UTSW 1 162836135 missense probably benign 0.00
R8207:Fmo1 UTSW 1 162850107 missense probably benign 0.28
R8895:Fmo1 UTSW 1 162830258 missense probably benign 0.01
R8917:Fmo1 UTSW 1 162836204 missense probably benign 0.03
X0022:Fmo1 UTSW 1 162830000 missense possibly damaging 0.57
X0066:Fmo1 UTSW 1 162839704 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCTGTCACTTAAGGAACAG -3'
(R):5'- TTTTCAGACCAAAGTGTGCAG -3'

Sequencing Primer
(F):5'- GCCTGTCACTTAAGGAACAGTAAATC -3'
(R):5'- GTATAACAAAACGCCCGGATTTTGC -3'
Posted On2018-03-15