Incidental Mutation 'R6263:Dnajc10'
ID506798
Institutional Source Beutler Lab
Gene Symbol Dnajc10
Ensembl Gene ENSMUSG00000027006
Gene NameDnaJ heat shock protein family (Hsp40) member C10
SynonymsJPDI, ERdj5, D2Ertd706e, 1200006L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location80315466-80354043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80343948 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 528 (V528E)
Ref Sequence ENSEMBL: ENSMUSP00000028392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028392]
PDB Structure Crystal structure of full-length ERdj5 [X-RAY DIFFRACTION]
Crystal structure of J-Trx1 fragment of ERdj5 [X-RAY DIFFRACTION]
Crystal structure of Trx4 domain of ERdj5 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028392
AA Change: V528E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028392
Gene: ENSMUSG00000027006
AA Change: V528E

DomainStartEndE-ValueType
DnaJ 34 92 9.73e-26 SMART
Pfam:Thioredoxin 130 232 5.6e-21 PFAM
low complexity region 384 392 N/A INTRINSIC
Pfam:Thioredoxin 454 553 2.3e-21 PFAM
Pfam:Thioredoxin 557 663 2e-21 PFAM
Pfam:Thioredoxin 672 776 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased endoplasmic reticulum stress in the salivary gland. Female homozygous mutant mice are smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Dnajc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Dnajc10 APN 2 80324752 splice site probably benign
IGL01420:Dnajc10 APN 2 80345023 missense possibly damaging 0.81
IGL01466:Dnajc10 APN 2 80321287 missense probably benign 0.00
IGL01645:Dnajc10 APN 2 80340527 missense possibly damaging 0.46
IGL01929:Dnajc10 APN 2 80328076 missense probably damaging 0.99
IGL01958:Dnajc10 APN 2 80321304 splice site probably benign
IGL02205:Dnajc10 APN 2 80349358 missense possibly damaging 0.74
IGL02289:Dnajc10 APN 2 80340526 missense probably damaging 0.98
IGL02661:Dnajc10 APN 2 80326740 splice site probably benign
IGL02865:Dnajc10 APN 2 80331303 missense probably benign
IGL03026:Dnajc10 APN 2 80349303 missense probably damaging 0.96
IGL03407:Dnajc10 APN 2 80346641 missense probably damaging 1.00
PIT4283001:Dnajc10 UTSW 2 80331395 missense probably benign 0.19
R0092:Dnajc10 UTSW 2 80325682 missense probably damaging 0.97
R0457:Dnajc10 UTSW 2 80344946 missense possibly damaging 0.65
R1414:Dnajc10 UTSW 2 80347677 missense probably damaging 0.99
R1739:Dnajc10 UTSW 2 80347662 missense probably benign 0.03
R2126:Dnajc10 UTSW 2 80350734 critical splice donor site probably null
R3717:Dnajc10 UTSW 2 80324745 splice site probably benign
R3718:Dnajc10 UTSW 2 80324745 splice site probably benign
R4020:Dnajc10 UTSW 2 80344952 missense probably damaging 1.00
R4453:Dnajc10 UTSW 2 80346623 missense probably damaging 0.98
R4585:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4586:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4772:Dnajc10 UTSW 2 80340526 missense probably damaging 0.98
R5653:Dnajc10 UTSW 2 80349368 missense probably damaging 1.00
R6157:Dnajc10 UTSW 2 80317391 start gained probably benign
R6303:Dnajc10 UTSW 2 80350664 missense probably benign 0.07
R6932:Dnajc10 UTSW 2 80331336 missense probably benign
R7104:Dnajc10 UTSW 2 80340815 missense probably damaging 1.00
R7181:Dnajc10 UTSW 2 80319243 nonsense probably null
R7458:Dnajc10 UTSW 2 80324750 splice site probably null
R7842:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
R8123:Dnajc10 UTSW 2 80349360 missense probably damaging 1.00
R8276:Dnajc10 UTSW 2 80349270 missense probably benign
R8365:Dnajc10 UTSW 2 80346558 missense probably damaging 1.00
R8915:Dnajc10 UTSW 2 80317457 missense possibly damaging 0.62
X0018:Dnajc10 UTSW 2 80350674 missense probably damaging 0.97
X0024:Dnajc10 UTSW 2 80344962 missense probably benign 0.19
Z1177:Dnajc10 UTSW 2 80319233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAGTAGTGGGTTTCTATCTACAGTC -3'
(R):5'- TCAGAAAAGAATCTCGTGGCAC -3'

Sequencing Primer
(F):5'- GTGAGAACAGCTGTCCATTAGTCC -3'
(R):5'- CTAGCCATAGCCTAGGATTT -3'
Posted On2018-03-15