Incidental Mutation 'R6263:Olfr1238'
ID506799
Institutional Source Beutler Lab
Gene Symbol Olfr1238
Ensembl Gene ENSMUSG00000111517
Gene Nameolfactory receptor 1238
SynonymsMOR231-11, GA_x6K02T2Q125-50849945-50848998
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89401991-89409676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89406730 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 116 (M116I)
Ref Sequence ENSEMBL: ENSMUSP00000150367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099781] [ENSMUST00000217226] [ENSMUST00000217237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099781
AA Change: M116I

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097369
Gene: ENSMUSG00000111517
AA Change: M116I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 6.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215283
Predicted Effect possibly damaging
Transcript: ENSMUST00000217226
AA Change: M116I

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217237
AA Change: M116I

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Olfr1238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Olfr1238 APN 2 89406331 missense possibly damaging 0.95
IGL01648:Olfr1238 APN 2 89406191 missense probably damaging 0.99
IGL03005:Olfr1238 APN 2 89406971 missense possibly damaging 0.95
R0450:Olfr1238 UTSW 2 89406791 missense probably damaging 0.99
R0469:Olfr1238 UTSW 2 89406791 missense probably damaging 0.99
R0510:Olfr1238 UTSW 2 89406791 missense probably damaging 0.99
R1983:Olfr1238 UTSW 2 89406426 missense probably benign 0.00
R4183:Olfr1238 UTSW 2 89406591 missense probably benign
R4737:Olfr1238 UTSW 2 89406486 missense probably benign 0.05
R4748:Olfr1238 UTSW 2 89406255 missense probably benign 0.02
R4749:Olfr1238 UTSW 2 89406255 missense probably benign 0.02
R4969:Olfr1238 UTSW 2 89406426 missense probably benign 0.00
R5047:Olfr1238 UTSW 2 89406713 missense probably damaging 1.00
R5992:Olfr1238 UTSW 2 89406879 missense probably benign 0.02
R6031:Olfr1238 UTSW 2 89406972 missense probably damaging 1.00
R6031:Olfr1238 UTSW 2 89406972 missense probably damaging 1.00
R6416:Olfr1238 UTSW 2 89406522 missense possibly damaging 0.78
R7352:Olfr1238 UTSW 2 89406462 missense probably benign 0.00
R7515:Olfr1238 UTSW 2 89406906 missense possibly damaging 0.91
R7796:Olfr1238 UTSW 2 89406813 missense possibly damaging 0.73
R7893:Olfr1238 UTSW 2 89407070 missense probably benign 0.00
R7976:Olfr1238 UTSW 2 89407070 missense probably benign 0.00
R8034:Olfr1238 UTSW 2 89406737 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATCAATGACATTGGGTCCACAG -3'
(R):5'- CCTGCTTATTGTGGCCACAG -3'

Sequencing Primer
(F):5'- TGACATTGGGTCCACAGAAAGG -3'
(R):5'- ATTGTGGCCACAGTGATTGCC -3'
Posted On2018-03-15