Incidental Mutation 'R6263:Pax6'
ID506801
Institutional Source Beutler Lab
Gene Symbol Pax6
Ensembl Gene ENSMUSG00000027168
Gene Namepaired box 6
SynonymsGsfaey11, Dey, Dickie's small eye, AEY11, Pax-6, 1500038E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location105668900-105697364 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 105692854 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090391] [ENSMUST00000090397] [ENSMUST00000111082] [ENSMUST00000111083] [ENSMUST00000111085] [ENSMUST00000111086] [ENSMUST00000111087] [ENSMUST00000111088] [ENSMUST00000167211]
Predicted Effect probably null
Transcript: ENSMUST00000090391
SMART Domains Protein: ENSMUSP00000087870
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090397
SMART Domains Protein: ENSMUSP00000087878
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111082
SMART Domains Protein: ENSMUSP00000106711
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111083
SMART Domains Protein: ENSMUSP00000106712
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111085
SMART Domains Protein: ENSMUSP00000106714
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111086
SMART Domains Protein: ENSMUSP00000106715
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111087
SMART Domains Protein: ENSMUSP00000106716
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111088
SMART Domains Protein: ENSMUSP00000106717
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
HOX 39 101 4.93e-26 SMART
low complexity region 110 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123063
SMART Domains Protein: ENSMUSP00000121345
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
HOX 9 71 2.5e-28 SMART
low complexity region 80 93 N/A INTRINSIC
Blast:PAX 121 169 6e-24 BLAST
low complexity region 186 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138365
SMART Domains Protein: ENSMUSP00000117154
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
PAX 33 192 4.87e-77 SMART
low complexity region 238 249 N/A INTRINSIC
SCOP:d1b72a_ 254 291 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146803
SMART Domains Protein: ENSMUSP00000133346
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
Blast:PAX 1 62 1e-26 BLAST
HOX 74 136 4.93e-26 SMART
low complexity region 145 158 N/A INTRINSIC
Blast:PAX 186 234 3e-23 BLAST
low complexity region 251 259 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153011
SMART Domains Protein: ENSMUSP00000118457
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 2 109 4.98e-42 SMART
low complexity region 155 166 N/A INTRINSIC
Pfam:Homeobox 192 218 7.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154643
Predicted Effect probably null
Transcript: ENSMUST00000167211
SMART Domains Protein: ENSMUSP00000129344
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a homeobox-containing protein that functions as a regulator of transcription. It plays a key role in the development of neural tissues, particularly the eye. Activity of this protein is also required for expression of glucagon in the pancreas. This gene is regulated by multiple enhancers located up to tens or hundreds of kilobases upstream and downstream of the transcription start sites. Mutations in this gene or deletion of these regulatory elements results in severe defects in eye development. Alternative splicing and the use of alternative promoters results in multiple transcript variants, some of which encode proteins that lack the N-terminal paired domain. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null and hypomorphic mutants show a range of phenotypes from viable with small eyes and lens/cornea fusion to microphthalmia and cataract to embryonic or perinatal lethality with anophthalmia and severe craniofacial and forebrain defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Pax6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Pax6 APN 2 105692278 critical splice donor site probably null
IGL02256:Pax6 APN 2 105684770 missense probably benign 0.16
IGL02500:Pax6 APN 2 105692770 missense probably benign 0.13
beady UTSW 2 105691691 missense probably damaging 1.00
red_hots UTSW 2 105695360 missense probably benign 0.00
G1citation:Pax6 UTSW 2 105685923 missense probably benign 0.04
R1067:Pax6 UTSW 2 105680301 missense probably benign 0.01
R1213:Pax6 UTSW 2 105685913 missense probably benign 0.13
R1494:Pax6 UTSW 2 105691610 missense probably benign 0.16
R1633:Pax6 UTSW 2 105691718 missense probably damaging 1.00
R2291:Pax6 UTSW 2 105685883 missense probably benign 0.09
R3834:Pax6 UTSW 2 105696450 missense probably benign 0.00
R3835:Pax6 UTSW 2 105696450 missense probably benign 0.00
R4665:Pax6 UTSW 2 105683998 intron probably benign
R4714:Pax6 UTSW 2 105695400 missense possibly damaging 0.74
R4747:Pax6 UTSW 2 105696502 missense probably benign
R4764:Pax6 UTSW 2 105696502 missense probably benign
R4767:Pax6 UTSW 2 105695360 missense probably benign 0.00
R4771:Pax6 UTSW 2 105696502 missense probably benign
R4772:Pax6 UTSW 2 105696502 missense probably benign
R4816:Pax6 UTSW 2 105683784 intron probably benign
R4819:Pax6 UTSW 2 105692277 critical splice donor site probably null
R5418:Pax6 UTSW 2 105691565 missense probably benign 0.00
R5683:Pax6 UTSW 2 105685907 missense probably benign 0.06
R6041:Pax6 UTSW 2 105683902 missense probably damaging 1.00
R6651:Pax6 UTSW 2 105685830 missense probably benign 0.00
R6822:Pax6 UTSW 2 105685923 missense probably benign 0.04
R7042:Pax6 UTSW 2 105696373 missense probably benign
R7088:Pax6 UTSW 2 105696408 missense probably benign 0.00
R7102:Pax6 UTSW 2 105692259 missense probably damaging 0.98
R7294:Pax6 UTSW 2 105684901 nonsense probably null
R7761:Pax6 UTSW 2 105691691 missense probably damaging 1.00
R7948:Pax6 UTSW 2 105685877 missense probably benign
R8882:Pax6 UTSW 2 105691618 missense possibly damaging 0.96
Z1177:Pax6 UTSW 2 105685816 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTGCCTTGTAATGAATGACCTTGC -3'
(R):5'- AGGCACATTAACTTGACTGAACAG -3'

Sequencing Primer
(F):5'- GTAATGAATGACCTTGCCCTCTC -3'
(R):5'- GGGCATGAATCAATCAATCAGTC -3'
Posted On2018-03-15