Mutagenetix > Incidental Mutations

Incidental Mutation 'R6263:Ino80'

506803

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R6263 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119383414 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1225 (Y1225C)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049920
AA Change: Y1225C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: Y1225C

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	A	2: 23,266,733		probably benign	Het
4932438A13Rik	T	A	3: 36,931,111	N863K	probably benign	Het
Ahnak	A	G	19: 9,018,277	I5642V	probably benign	Het
Atp5a1	A	G	18: 77,779,230		probably null	Het
Bsn	A	T	9: 108,113,254	F1766L	probably damaging	Het
Ccdc141	T	C	2: 77,108,463	Q266R	probably damaging	Het
Cdh10	T	A	15: 18,964,068	D105E	possibly damaging	Het
Clca3a1	T	A	3: 144,749,778	D418V	probably damaging	Het
Cnnm2	C	A	19: 46,856,905	T612K	probably benign	Het
Col3a1	T	C	1: 45,321,575	V55A	unknown	Het
Cpd	A	C	11: 76,846,271	D232E	probably benign	Het
Csde1	A	G	3: 103,040,017	H95R	probably benign	Het
Ctcfl	T	A	2: 173,095,337	H596L	probably benign	Het
Cwc22	T	C	2: 77,896,171	R855G	possibly damaging	Het
Cwc25	A	G	11: 97,753,227	Y227H	probably damaging	Het
Cyp2c38	G	A	19: 39,392,215	P409S	probably damaging	Het
Ddx5	A	G	11: 106,788,313	S2P	possibly damaging	Het
Dnah2	C	A	11: 69,457,412	G2570W	probably damaging	Het
Dnajc10	T	A	2: 80,343,948	V528E	probably damaging	Het
Fmo1	A	G	1: 162,850,060		probably null	Het
Gm11639	G	A	11: 104,919,486	D3150N	unknown	Het
Gpatch1	C	A	7: 35,303,423	D221Y	probably damaging	Het
Itga7	T	A	10: 128,944,086	D501E	probably benign	Het
Lgr4	T	C	2: 110,011,898	S743P	possibly damaging	Het
Lilra5	A	T	7: 4,238,361	Y99F	probably damaging	Het
Lmna	A	G	3: 88,502,958	V49A	probably damaging	Het
Lrrc72	G	A	12: 36,208,604	R267*	probably null	Het
Mapkbp1	T	C	2: 120,023,291	S1199P	probably damaging	Het
Mmp25	G	A	17: 23,630,794	A541V	possibly damaging	Het
Myh10	A	T	11: 68,810,232	N1756Y	probably damaging	Het
Nfe2	A	G	15: 103,250,951	I31T	probably damaging	Het
Nfe2l1	A	T	11: 96,817,744	F732I	probably benign	Het
Olfr1238	C	G	2: 89,406,730	M116I	possibly damaging	Het
Olfr1255	T	A	2: 89,816,760	C145S	probably damaging	Het
Olfr603	C	A	7: 103,383,196	V269F	possibly damaging	Het
Pax6	T	C	2: 105,692,854		probably null	Het
Phb	A	G	11: 95,678,115	E192G	probably damaging	Het
Plekhn1	A	T	4: 156,225,193		probably null	Het
Plxnb2	A	T	15: 89,161,986	V942E	probably damaging	Het
Rsrc2	G	A	5: 123,739,688		probably benign	Het
Sept8	G	A	11: 53,548,383	C460Y	probably benign	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc16a7	A	G	10: 125,294,639	I59T	probably benign	Het
Slc35d1	A	T	4: 103,208,168	I172N	possibly damaging	Het
Smg5	A	T	3: 88,341,901	N40Y	possibly damaging	Het
Smurf1	A	G	5: 144,881,731	V633A	probably damaging	Het
Snx9	T	C	17: 5,887,049	V22A	probably damaging	Het
Sox6	A	T	7: 115,477,060	M741K	probably damaging	Het
Spata31d1d	T	C	13: 59,725,983	Q1246R	probably benign	Het
Sval1	A	G	6: 41,951,726	E24G	probably damaging	Het
Tas2r124	A	G	6: 132,754,904	I59V	probably benign	Het
Tmem151b	T	A	17: 45,547,066	T85S	probably benign	Het
Tpr	T	A	1: 150,442,245		probably null	Het
Trpm6	A	C	19: 18,854,108	T1446P	possibly damaging	Het
Tsc22d4	A	T	5: 137,768,179	K502N	possibly damaging	Het
Tssk3	C	T	4: 129,489,258	S207N	probably benign	Het
Ttbk1	G	T	17: 46,467,262	P618Q	probably damaging	Het
Ttll6	A	T	11: 96,156,545	M657L	probably benign	Het
Ubash3a	T	A	17: 31,215,095	I138N	probably benign	Het
Ush2a	A	G	1: 188,358,642	Y490C	probably damaging	Het
Vmn1r82	G	T	7: 12,305,534	V127F	probably damaging	Het
Vmn2r32	A	T	7: 7,476,692	S161T	possibly damaging	Het
Wdr49	T	C	3: 75,481,517	I58M	possibly damaging	Het
Wiz	A	T	17: 32,360,443		probably null	Het
Wrap53	A	T	11: 69,562,793	Y324*	probably null	Het
Zfp747	A	C	7: 127,375,966		probably benign	Het
Zfp827	A	G	8: 79,179,073	Y33C	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTATCAGTGTACACAGGAGC -3'
(R):5'- TGGCTATACTGCTCTCAGAATTTC -3'

Sequencing Primer
(F):5'- GTAAGGTACAGGCTCCAATGCTTAC -3'
(R):5'- AGAATTTCTGTCCTGCACTCAGAAC -3'

Posted On

2018-03-15