Incidental Mutation 'R6263:Vmn2r32'
ID 506821
Institutional Source Beutler Lab
Gene Symbol Vmn2r32
Ensembl Gene ENSMUSG00000096743
Gene Name vomeronasal 2, receptor 32
Synonyms V2r5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R6263 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 7463015-7479973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7476692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 161 (S161T)
Ref Sequence ENSEMBL: ENSMUSP00000092462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094866]
AlphaFold K7N686
Predicted Effect possibly damaging
Transcript: ENSMUST00000094866
AA Change: S161T

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092462
Gene: ENSMUSG00000096743
AA Change: S161T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 3.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 9.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Vmn2r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Vmn2r32 APN 7 7476697 missense probably damaging 0.97
IGL02333:Vmn2r32 APN 7 7464144 missense probably damaging 1.00
IGL02406:Vmn2r32 APN 7 7476710 missense probably benign
IGL02428:Vmn2r32 APN 7 7474284 missense probably benign 0.02
IGL02484:Vmn2r32 APN 7 7464117 missense probably damaging 1.00
IGL03277:Vmn2r32 APN 7 7474252 missense probably benign 0.23
IGL03366:Vmn2r32 APN 7 7464030 missense probably damaging 0.99
R1055:Vmn2r32 UTSW 7 7474327 nonsense probably null
R1695:Vmn2r32 UTSW 7 7463992 missense probably benign 0.01
R2172:Vmn2r32 UTSW 7 7474615 missense probably damaging 0.99
R2262:Vmn2r32 UTSW 7 7474619 missense probably benign
R3150:Vmn2r32 UTSW 7 7472555 missense probably benign
R4362:Vmn2r32 UTSW 7 7479858 nonsense probably null
R4432:Vmn2r32 UTSW 7 7479919 missense probably damaging 0.98
R4851:Vmn2r32 UTSW 7 7479954 missense possibly damaging 0.59
R4949:Vmn2r32 UTSW 7 7464084 missense probably benign 0.22
R5990:Vmn2r32 UTSW 7 7479810 missense probably damaging 0.97
R6083:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6084:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6116:Vmn2r32 UTSW 7 7464093 missense probably damaging 1.00
R6889:Vmn2r32 UTSW 7 7472574 missense possibly damaging 0.82
R7286:Vmn2r32 UTSW 7 7479808 missense probably benign 0.21
R7390:Vmn2r32 UTSW 7 7479852 missense probably benign 0.00
R7412:Vmn2r32 UTSW 7 7474213 missense possibly damaging 0.53
R7508:Vmn2r32 UTSW 7 7467374 missense possibly damaging 0.87
R8812:Vmn2r32 UTSW 7 7474670 missense probably damaging 1.00
R8968:Vmn2r32 UTSW 7 7474205 missense probably benign 0.00
R9331:Vmn2r32 UTSW 7 7464403 nonsense probably null
R9358:Vmn2r32 UTSW 7 7474198 missense probably damaging 1.00
Z1177:Vmn2r32 UTSW 7 7474161 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTGACTTAATTCTACATGGC -3'
(R):5'- CAGATACTCTTTGGGCCATTGTG -3'

Sequencing Primer
(F):5'- ATCTGTCAACTTCTGGTGGTAGTAAC -3'
(R):5'- GTGATGGAAAAACTGTAACACCTAC -3'
Posted On 2018-03-15