Incidental Mutation 'R6263:Gpatch1'
ID506823
Institutional Source Beutler Lab
Gene Symbol Gpatch1
Ensembl Gene ENSMUSG00000063808
Gene NameG patch domain containing 1
SynonymsGpatc1, 1300003A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35276536-35318440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35303423 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 221 (D221Y)
Ref Sequence ENSEMBL: ENSMUSP00000117475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079693] [ENSMUST00000131143] [ENSMUST00000131213]
Predicted Effect probably damaging
Transcript: ENSMUST00000079693
AA Change: D221Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078632
Gene: ENSMUSG00000063808
AA Change: D221Y

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 2.1e-39 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 847 897 N/A INTRINSIC
low complexity region 899 909 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131143
SMART Domains Protein: ENSMUSP00000121711
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 29 98 2.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131213
AA Change: D221Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117475
Gene: ENSMUSG00000063808
AA Change: D221Y

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 7.9e-40 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 849 881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Gpatch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gpatch1 APN 7 35276813 critical splice acceptor site probably null
IGL01143:Gpatch1 APN 7 35301572 splice site probably benign
IGL01523:Gpatch1 APN 7 35308338 missense probably null 1.00
IGL01862:Gpatch1 APN 7 35295278 missense probably benign
IGL02349:Gpatch1 APN 7 35307255 missense probably damaging 1.00
IGL02792:Gpatch1 APN 7 35301593 missense probably damaging 0.96
IGL02926:Gpatch1 APN 7 35308269 missense probably damaging 1.00
IGL03099:Gpatch1 APN 7 35297523 missense possibly damaging 0.87
IGL03107:Gpatch1 APN 7 35303317 missense probably benign 0.35
IGL03324:Gpatch1 APN 7 35299280 missense probably damaging 0.96
IGL03324:Gpatch1 APN 7 35293695 missense possibly damaging 0.81
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0137:Gpatch1 UTSW 7 35287242 missense probably damaging 1.00
R0347:Gpatch1 UTSW 7 35297631 missense probably benign 0.16
R0382:Gpatch1 UTSW 7 35301655 missense probably damaging 1.00
R0390:Gpatch1 UTSW 7 35281381 intron probably benign
R0791:Gpatch1 UTSW 7 35281376 intron probably benign
R1162:Gpatch1 UTSW 7 35303480 splice site probably benign
R1374:Gpatch1 UTSW 7 35291762 missense probably damaging 1.00
R1480:Gpatch1 UTSW 7 35303338 missense probably damaging 1.00
R1556:Gpatch1 UTSW 7 35295351 missense probably benign 0.00
R1682:Gpatch1 UTSW 7 35303387 missense possibly damaging 0.80
R1887:Gpatch1 UTSW 7 35303388 missense probably damaging 0.98
R1935:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R1936:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R2148:Gpatch1 UTSW 7 35299276 missense probably benign 0.16
R2205:Gpatch1 UTSW 7 35291772 missense probably damaging 1.00
R2215:Gpatch1 UTSW 7 35293827 missense possibly damaging 0.48
R2274:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R2275:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R4126:Gpatch1 UTSW 7 35293654 critical splice donor site probably null
R4705:Gpatch1 UTSW 7 35299305 splice site probably null
R5227:Gpatch1 UTSW 7 35309351 missense probably benign 0.09
R5567:Gpatch1 UTSW 7 35307215 missense probably damaging 0.99
R5810:Gpatch1 UTSW 7 35295371 missense probably benign 0.01
R5946:Gpatch1 UTSW 7 35291832 missense probably damaging 0.99
R6386:Gpatch1 UTSW 7 35291840 missense probably damaging 1.00
R6569:Gpatch1 UTSW 7 35291738 missense probably damaging 1.00
R6847:Gpatch1 UTSW 7 35293558 splice site probably null
R7186:Gpatch1 UTSW 7 35295313 missense possibly damaging 0.86
R7259:Gpatch1 UTSW 7 35287121 critical splice donor site probably null
R7276:Gpatch1 UTSW 7 35297496 missense probably benign 0.00
R7516:Gpatch1 UTSW 7 35308200 missense probably benign 0.09
R7521:Gpatch1 UTSW 7 35293788 missense probably damaging 1.00
R7561:Gpatch1 UTSW 7 35309375 missense probably damaging 1.00
R7570:Gpatch1 UTSW 7 35293812 missense probably damaging 1.00
R7588:Gpatch1 UTSW 7 35291748 missense probably damaging 1.00
R7843:Gpatch1 UTSW 7 35281454 missense unknown
R8353:Gpatch1 UTSW 7 35277279 intron probably benign
R8430:Gpatch1 UTSW 7 35308209 missense probably damaging 1.00
R8669:Gpatch1 UTSW 7 35291779 missense probably damaging 1.00
X0020:Gpatch1 UTSW 7 35295381 missense probably benign 0.09
Z1176:Gpatch1 UTSW 7 35310485 missense probably damaging 1.00
Z1186:Gpatch1 UTSW 7 35281372 missense unknown
Z1186:Gpatch1 UTSW 7 35297654 missense possibly damaging 0.91
Z1186:Gpatch1 UTSW 7 35318345 missense probably benign
Z1191:Gpatch1 UTSW 7 35281372 missense unknown
Z1191:Gpatch1 UTSW 7 35297654 missense possibly damaging 0.91
Z1191:Gpatch1 UTSW 7 35318345 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGTTACTGCTTTTACAACATGG -3'
(R):5'- TGGTCATTGATGGCAGCAG -3'

Sequencing Primer
(F):5'- CATGGAAACTTTTACCTGGCCAG -3'
(R):5'- TCATTGATGGCAGCAGAAGTAC -3'
Posted On2018-03-15