Incidental Mutation 'R6263:Itga7'
ID506831
Institutional Source Beutler Lab
Gene Symbol Itga7
Ensembl Gene ENSMUSG00000025348
Gene Nameintegrin alpha 7
Synonyms[a]7, alpha7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128933818-128958282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128944086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 501 (D501E)
Ref Sequence ENSEMBL: ENSMUSP00000151960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099112] [ENSMUST00000218290]
Predicted Effect probably benign
Transcript: ENSMUST00000099112
AA Change: D497E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: D497E

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158143
Predicted Effect probably benign
Transcript: ENSMUST00000218290
AA Change: D501E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218387
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Itga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Itga7 APN 10 128941854 missense possibly damaging 0.67
IGL00809:Itga7 APN 10 128939169 critical splice donor site probably null
IGL01448:Itga7 APN 10 128949468 nonsense probably null
IGL01675:Itga7 APN 10 128946855 missense probably damaging 1.00
IGL02158:Itga7 APN 10 128953782 missense possibly damaging 0.95
IGL02475:Itga7 APN 10 128934089 missense probably damaging 1.00
IGL02689:Itga7 APN 10 128946818 missense possibly damaging 0.83
IGL02946:Itga7 APN 10 128934083 missense probably benign
IGL03223:Itga7 APN 10 128948811 unclassified probably benign
R0662:Itga7 UTSW 10 128953531 missense probably damaging 1.00
R0972:Itga7 UTSW 10 128942877 missense probably damaging 0.98
R1449:Itga7 UTSW 10 128953501 missense probably benign 0.13
R1521:Itga7 UTSW 10 128957811 missense possibly damaging 0.63
R1597:Itga7 UTSW 10 128946863 missense probably benign 0.17
R1651:Itga7 UTSW 10 128948824 missense probably benign 0.01
R4718:Itga7 UTSW 10 128940734 frame shift probably null
R5011:Itga7 UTSW 10 128949447 missense possibly damaging 0.51
R5151:Itga7 UTSW 10 128944511 missense possibly damaging 0.91
R5287:Itga7 UTSW 10 128943158 missense probably benign 0.38
R5419:Itga7 UTSW 10 128944033 missense probably null 0.06
R5907:Itga7 UTSW 10 128942981 missense probably damaging 1.00
R6165:Itga7 UTSW 10 128942935 missense probably benign 0.16
R6189:Itga7 UTSW 10 128950403 missense possibly damaging 0.76
R6612:Itga7 UTSW 10 128948993 missense possibly damaging 0.65
R6746:Itga7 UTSW 10 128949472 missense probably benign 0.13
R6850:Itga7 UTSW 10 128945516 missense probably damaging 1.00
R7226:Itga7 UTSW 10 128940932 missense probably damaging 0.98
R7257:Itga7 UTSW 10 128944413 missense possibly damaging 0.55
R7344:Itga7 UTSW 10 128940929 missense possibly damaging 0.63
R7456:Itga7 UTSW 10 128941936 missense probably damaging 1.00
R7545:Itga7 UTSW 10 128933906 start gained probably benign
R7643:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7644:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7822:Itga7 UTSW 10 128942966 missense probably benign 0.00
R7998:Itga7 UTSW 10 128934151 missense probably damaging 1.00
X0020:Itga7 UTSW 10 128942877 missense probably damaging 0.98
Z1088:Itga7 UTSW 10 128949163 missense probably benign 0.10
Z1176:Itga7 UTSW 10 128953827 missense probably benign 0.12
Z1177:Itga7 UTSW 10 128943214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATACCGCTGCTCTGTTCAG -3'
(R):5'- ACAGATCTTTATGTCCACACTGTG -3'

Sequencing Primer
(F):5'- AAATCCCCCTTGAAGGTGTG -3'
(R):5'- TGGGGCAAAGGGAGACTTCTTAG -3'
Posted On2018-03-15