Incidental Mutation 'R6263:Ddx5'
ID 506843
Institutional Source Beutler Lab
Gene Symbol Ddx5
Ensembl Gene ENSMUSG00000020719
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Synonyms Hlr1, p68, 2600009A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6263 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 106780355-106789185 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106788313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000138184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000021062] [ENSMUST00000103068] [ENSMUST00000123339] [ENSMUST00000127481] [ENSMUST00000129585] [ENSMUST00000133426]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018516
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000021062
AA Change: S2P
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103068
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106779
SMART Domains Protein: ENSMUSP00000102391
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 3e-38 BLAST
PDB:4A4D|A 52 86 4e-17 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000123339
AA Change: S2P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121733
Gene: ENSMUSG00000020719
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 7e-37 BLAST
Pfam:DEAD 118 161 1.8e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127481
AA Change: S2P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000129585
AA Change: S2P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116859
Gene: ENSMUSG00000020719
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 8e-37 BLAST
Pfam:DEAD 118 183 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130172
Predicted Effect unknown
Transcript: ENSMUST00000133426
AA Change: S2P
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151741
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter/null allele die around E11.5 displaying blood vessel malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Ddx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Ddx5 APN 11 106785009 missense probably damaging 0.99
IGL02975:Ddx5 APN 11 106781885 missense probably benign 0.00
IGL03037:Ddx5 APN 11 106782104 missense possibly damaging 0.82
IGL03046:Ddx5 UTSW 11 106785045 missense probably damaging 1.00
R0544:Ddx5 UTSW 11 106782462 unclassified probably benign
R1186:Ddx5 UTSW 11 106783979 splice site probably null
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1839:Ddx5 UTSW 11 106784897 missense probably benign 0.02
R3781:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R3782:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R4968:Ddx5 UTSW 11 106784127 missense probably damaging 1.00
R4973:Ddx5 UTSW 11 106785007 missense possibly damaging 0.94
R4995:Ddx5 UTSW 11 106785236 missense probably damaging 1.00
R5839:Ddx5 UTSW 11 106782206 missense probably damaging 0.97
R6314:Ddx5 UTSW 11 106788521 unclassified probably benign
R6341:Ddx5 UTSW 11 106785542 splice site probably null
R6707:Ddx5 UTSW 11 106782232 missense probably benign 0.00
R7424:Ddx5 UTSW 11 106782180 missense probably benign 0.12
R7910:Ddx5 UTSW 11 106784435 missense probably damaging 1.00
R8145:Ddx5 UTSW 11 106782085 missense probably benign 0.03
R8849:Ddx5 UTSW 11 106785149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGACGTGTGACAAAAGC -3'
(R):5'- GGCGGTCCAGACTATAAAAGC -3'

Sequencing Primer
(F):5'- GTGTGACAAAAGCCAGGCCTC -3'
(R):5'- GTCCAGACTATAAAAGCGGCTGC -3'
Posted On 2018-03-15