Mutagenetix > Incidental Mutation

Incidental Mutation 'R6263:Snx9'

506849

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

044437-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R6263 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5887049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 22 (V22A)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

AlphaFold

Q91VH2

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002436
AA Change: V22A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: V22A

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231803

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	A	2: 23,266,733		probably benign	Het
4932438A13Rik	T	A	3: 36,931,111	N863K	probably benign	Het
Ahnak	A	G	19: 9,018,277	I5642V	probably benign	Het
Atp5a1	A	G	18: 77,779,230		probably null	Het
Bsn	A	T	9: 108,113,254	F1766L	probably damaging	Het
Ccdc141	T	C	2: 77,108,463	Q266R	probably damaging	Het
Cdh10	T	A	15: 18,964,068	D105E	possibly damaging	Het
Clca3a1	T	A	3: 144,749,778	D418V	probably damaging	Het
Cnnm2	C	A	19: 46,856,905	T612K	probably benign	Het
Col3a1	T	C	1: 45,321,575	V55A	unknown	Het
Cpd	A	C	11: 76,846,271	D232E	probably benign	Het
Csde1	A	G	3: 103,040,017	H95R	probably benign	Het
Ctcfl	T	A	2: 173,095,337	H596L	probably benign	Het
Cwc22	T	C	2: 77,896,171	R855G	possibly damaging	Het
Cwc25	A	G	11: 97,753,227	Y227H	probably damaging	Het
Cyp2c38	G	A	19: 39,392,215	P409S	probably damaging	Het
Ddx5	A	G	11: 106,788,313	S2P	possibly damaging	Het
Dnah2	C	A	11: 69,457,412	G2570W	probably damaging	Het
Dnajc10	T	A	2: 80,343,948	V528E	probably damaging	Het
Fmo1	A	G	1: 162,850,060		probably null	Het
Gm11639	G	A	11: 104,919,486	D3150N	unknown	Het
Gpatch1	C	A	7: 35,303,423	D221Y	probably damaging	Het
Ino80	T	C	2: 119,383,414	Y1225C	probably damaging	Het
Itga7	T	A	10: 128,944,086	D501E	probably benign	Het
Lgr4	T	C	2: 110,011,898	S743P	possibly damaging	Het
Lilra5	A	T	7: 4,238,361	Y99F	probably damaging	Het
Lmna	A	G	3: 88,502,958	V49A	probably damaging	Het
Lrrc72	G	A	12: 36,208,604	R267*	probably null	Het
Mapkbp1	T	C	2: 120,023,291	S1199P	probably damaging	Het
Mmp25	G	A	17: 23,630,794	A541V	possibly damaging	Het
Myh10	A	T	11: 68,810,232	N1756Y	probably damaging	Het
Nfe2	A	G	15: 103,250,951	I31T	probably damaging	Het
Nfe2l1	A	T	11: 96,817,744	F732I	probably benign	Het
Olfr1238	C	G	2: 89,406,730	M116I	possibly damaging	Het
Olfr1255	T	A	2: 89,816,760	C145S	probably damaging	Het
Olfr603	C	A	7: 103,383,196	V269F	possibly damaging	Het
Pax6	T	C	2: 105,692,854		probably null	Het
Phb	A	G	11: 95,678,115	E192G	probably damaging	Het
Plekhn1	A	T	4: 156,225,193		probably null	Het
Plxnb2	A	T	15: 89,161,986	V942E	probably damaging	Het
Rsrc2	G	A	5: 123,739,688		probably benign	Het
Sept8	G	A	11: 53,548,383	C460Y	probably benign	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc16a7	A	G	10: 125,294,639	I59T	probably benign	Het
Slc35d1	A	T	4: 103,208,168	I172N	possibly damaging	Het
Smg5	A	T	3: 88,341,901	N40Y	possibly damaging	Het
Smurf1	A	G	5: 144,881,731	V633A	probably damaging	Het
Sox6	A	T	7: 115,477,060	M741K	probably damaging	Het
Spata31d1d	T	C	13: 59,725,983	Q1246R	probably benign	Het
Sval1	A	G	6: 41,951,726	E24G	probably damaging	Het
Tas2r124	A	G	6: 132,754,904	I59V	probably benign	Het
Tmem151b	T	A	17: 45,547,066	T85S	probably benign	Het
Tpr	T	A	1: 150,442,245		probably null	Het
Trpm6	A	C	19: 18,854,108	T1446P	possibly damaging	Het
Tsc22d4	A	T	5: 137,768,179	K502N	possibly damaging	Het
Tssk3	C	T	4: 129,489,258	S207N	probably benign	Het
Ttbk1	G	T	17: 46,467,262	P618Q	probably damaging	Het
Ttll6	A	T	11: 96,156,545	M657L	probably benign	Het
Ubash3a	T	A	17: 31,215,095	I138N	probably benign	Het
Ush2a	A	G	1: 188,358,642	Y490C	probably damaging	Het
Vmn1r82	G	T	7: 12,305,534	V127F	probably damaging	Het
Vmn2r32	A	T	7: 7,476,692	S161T	possibly damaging	Het
Wdr49	T	C	3: 75,481,517	I58M	possibly damaging	Het
Wiz	A	T	17: 32,360,443		probably null	Het
Wrap53	A	T	11: 69,562,793	Y324*	probably null	Het
Zfp747	A	C	7: 127,375,966		probably benign	Het
Zfp827	A	G	8: 79,179,073	Y33C	probably damaging	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00
R9451:Snx9	UTSW	17	5899493	missense	probably damaging	0.99
R9748:Snx9	UTSW	17	5899395	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCTGAAGGAGCTAGGTGTCC -3'
(R):5'- GCTGAACTTCTCTAGGTGTGC -3'

Sequencing Primer
(F):5'- AGCTAGGTGTCCTGAACTGTCTC -3'
(R):5'- CATGTGACAGCTTCTTGTAGCATCAG -3'

Posted On

2018-03-15