Incidental Mutation 'R6263:Mmp25'
ID506850
Institutional Source Beutler Lab
Gene Symbol Mmp25
Ensembl Gene ENSMUSG00000023903
Gene Namematrix metallopeptidase 25
SynonymsLeukolysin, MT6-MMP, F730048C11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23629458-23645269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23630794 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 541 (A541V)
Ref Sequence ENSEMBL: ENSMUSP00000024696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024696
AA Change: A541V

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024696
Gene: ENSMUSG00000023903
AA Change: A541V

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:PG_binding_1 82 140 8.8e-12 PFAM
ZnMc 166 335 1.68e-47 SMART
low complexity region 343 369 N/A INTRINSIC
HX 375 419 6.35e-8 SMART
HX 424 466 1.62e-5 SMART
HX 470 516 1.64e-10 SMART
HX 518 562 2.79e-4 SMART
low complexity region 572 581 N/A INTRINSIC
low complexity region 597 607 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded precursor undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Mmp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Mmp25 APN 17 23639762 missense probably damaging 1.00
IGL02893:Mmp25 APN 17 23644051 missense probably damaging 1.00
R0471:Mmp25 UTSW 17 23639884 missense possibly damaging 0.73
R0478:Mmp25 UTSW 17 23632782 missense probably benign 0.08
R1829:Mmp25 UTSW 17 23640023 missense probably benign 0.00
R2005:Mmp25 UTSW 17 23640242 missense probably damaging 1.00
R2151:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R2153:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R2154:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R2937:Mmp25 UTSW 17 23644791 missense probably benign 0.00
R4418:Mmp25 UTSW 17 23644070 missense probably damaging 1.00
R4667:Mmp25 UTSW 17 23644607 missense probably benign 0.00
R4905:Mmp25 UTSW 17 23644048 nonsense probably null
R5535:Mmp25 UTSW 17 23644760 missense probably benign
R5592:Mmp25 UTSW 17 23640202 missense possibly damaging 0.95
R5888:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R6261:Mmp25 UTSW 17 23630794 missense possibly damaging 0.61
R6264:Mmp25 UTSW 17 23630794 missense possibly damaging 0.61
R6571:Mmp25 UTSW 17 23639896 missense probably benign 0.17
R7172:Mmp25 UTSW 17 23644788 missense probably benign
R7467:Mmp25 UTSW 17 23644782 missense possibly damaging 0.53
R8109:Mmp25 UTSW 17 23644794 missense probably benign 0.00
T0722:Mmp25 UTSW 17 23631218 missense possibly damaging 0.94
Z1176:Mmp25 UTSW 17 23630659 missense probably damaging 1.00
Z1177:Mmp25 UTSW 17 23644137 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACAAGGAAGGACCAGGTTTC -3'
(R):5'- TGCAAATTGTGATCCCTGGG -3'

Sequencing Primer
(F):5'- TTTCAGTAAGAAAAGACCTCTCCAG -3'
(R):5'- TTGTGATCCCTGGGAGAGAAAAG -3'
Posted On2018-03-15