Incidental Mutation 'R6263:Ttbk1'
ID506853
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6263 (G1)
Quality Score189.009
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46467262 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 618 (P618Q)
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000225808]
Predicted Effect probably damaging
Transcript: ENSMUST00000047034
AA Change: P618Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: P618Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect probably damaging
Transcript: ENSMUST00000225808
AA Change: P618Q

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AACTCTAGGGATCTCTGGGTAGG -3'
(R):5'- TATTGACAAGGAGACGGAGCTC -3'

Sequencing Primer
(F):5'- GGAGGTAATGTACAAGTCCAGTC -3'
(R):5'- AGACGGAGCTCAAGGACTTCC -3'
Posted On2018-03-15