Incidental Mutation 'R6263:Atp5a1'
ID506854
Institutional Source Beutler Lab
Gene Symbol Atp5a1
Ensembl Gene ENSMUSG00000025428
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
SynonymsAtpm, Mom2, D18Ertd206e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77773729-77782869 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 77779230 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026495] [ENSMUST00000114748] [ENSMUST00000135678]
Predicted Effect probably null
Transcript: ENSMUST00000026495
SMART Domains Protein: ENSMUSP00000026495
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:ATP-synt_ab_N 67 135 3.4e-17 PFAM
Pfam:ATP-synt_ab 192 415 5.7e-76 PFAM
Pfam:ATP-synt_ab_C 427 528 1.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114748
SMART Domains Protein: ENSMUSP00000110396
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 17 85 1.1e-19 PFAM
Pfam:ATP-synt_ab 141 365 4.8e-75 PFAM
Pfam:ATP-synt_ab_C 377 479 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128073
Predicted Effect probably benign
Transcript: ENSMUST00000135678
SMART Domains Protein: ENSMUSP00000120436
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
PDB:2W6J|C 22 78 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146869
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a targeted mutation of this gene display preweaning and embryonic lethality. Heterozygous mutants exhibit decreased body weight and lean body mass and reduced circulating insulin, serum albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Atp5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Atp5a1 APN 18 77777533 missense probably damaging 1.00
IGL01536:Atp5a1 APN 18 77780312 intron probably benign
IGL01585:Atp5a1 APN 18 77781058 missense possibly damaging 0.95
IGL02973:Atp5a1 APN 18 77780149 missense probably damaging 1.00
R0268:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0344:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0399:Atp5a1 UTSW 18 77781836 nonsense probably null
R0464:Atp5a1 UTSW 18 77779922 missense probably benign 0.04
R1471:Atp5a1 UTSW 18 77781269 missense probably damaging 1.00
R1476:Atp5a1 UTSW 18 77781925 missense probably benign 0.00
R1630:Atp5a1 UTSW 18 77777567 missense possibly damaging 0.94
R2102:Atp5a1 UTSW 18 77782317 missense probably damaging 0.99
R4424:Atp5a1 UTSW 18 77780066 intron probably benign
R4746:Atp5a1 UTSW 18 77778742 missense probably benign 0.00
R4864:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R5191:Atp5a1 UTSW 18 77780229 missense probably damaging 1.00
R6217:Atp5a1 UTSW 18 77781356 missense probably benign
R6262:Atp5a1 UTSW 18 77781212 missense probably damaging 1.00
R6284:Atp5a1 UTSW 18 77778468 missense probably benign 0.30
R6873:Atp5a1 UTSW 18 77775840 nonsense probably null
R7442:Atp5a1 UTSW 18 77779120 missense probably benign 0.04
R7661:Atp5a1 UTSW 18 77774102 missense possibly damaging 0.70
R7696:Atp5a1 UTSW 18 77780986 missense probably damaging 1.00
R7846:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R7929:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
X0021:Atp5a1 UTSW 18 77781273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGATCCTGCATTTAGTGACATT -3'
(R):5'- TGGAACCCACAGAGAAGTGA -3'

Sequencing Primer
(F):5'- GTGACATTTTTGCCTCTCTTAAAGG -3'
(R):5'- CAAGGTCCCAGGTTTGATCCTAG -3'
Posted On2018-03-15