Incidental Mutation 'R6264:Pik3ca'
ID506868
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
SynonymscaPI3K, 6330412C24Rik, p110alpha
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32397671-32468486 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 32440714 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
Predicted Effect probably null
Transcript: ENSMUST00000029201
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108242
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108243
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32462584 missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32450026 missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32459935 missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32439886 missense probably benign 0.27
IGL03401:Pik3ca APN 3 32437814 splice site probably null
Peninsular UTSW 3 32462821 missense probably benign 0.38
R0084:Pik3ca UTSW 3 32462788 missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32459945 missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32439753 missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32461511 missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32450261 critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32436552 missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32450027 missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32456093 missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32454420 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32450350 missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32443867 missense probably benign 0.27
R1969:Pik3ca UTSW 3 32451754 critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32450057 missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32437927 missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32462794 nonsense probably null
R2680:Pik3ca UTSW 3 32436548 nonsense probably null
R2680:Pik3ca UTSW 3 32443885 missense probably benign 0.00
R3001:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32439935 nonsense probably null
R4416:Pik3ca UTSW 3 32461530 missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32437978 missense probably benign 0.20
R4822:Pik3ca UTSW 3 32437982 missense probably benign 0.04
R4856:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32450053 missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32461560 missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32462779 missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32461563 missense probably damaging 1.00
R6347:Pik3ca UTSW 3 32462821 missense probably benign 0.38
R6538:Pik3ca UTSW 3 32439704 missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32436279 missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32436218 missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32443613 nonsense probably null
R7947:Pik3ca UTSW 3 32443613 nonsense probably null
Z1177:Pik3ca UTSW 3 32437967 missense not run
Predicted Primers PCR Primer
(F):5'- GTGGTCAAGAGGCTCTATCAG -3'
(R):5'- TCATTTGAAGGAGAGACTGCC -3'

Sequencing Primer
(F):5'- GTCAAGAGGCTCTATCAGTTCATTG -3'
(R):5'- GAGACTGCCTTAAAGTTCAGGTC -3'
Posted On2018-03-15