Incidental Mutation 'R6264:Prkg2'
ID506877
Institutional Source Beutler Lab
Gene Symbol Prkg2
Ensembl Gene ENSMUSG00000029334
Gene Nameprotein kinase, cGMP-dependent, type II
SynonymsPrkgr2, cGK-II
Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location98929773-99037351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98934364 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 52 (K52Q)
Ref Sequence ENSEMBL: ENSMUSP00000142743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490] [ENSMUST00000162147] [ENSMUST00000162619]
Predicted Effect probably benign
Transcript: ENSMUST00000031277
AA Change: K691Q

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: K691Q

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 424 682 9.46e-75 SMART
S_TK_X 683 733 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161490
AA Change: K720Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: K720Q

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 453 711 1.19e-89 SMART
S_TK_X 712 762 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162147
AA Change: K65Q

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000143708
Gene: ENSMUSG00000029334
AA Change: K65Q

DomainStartEndE-ValueType
Blast:S_TKc 1 56 3e-32 BLAST
S_TK_X 57 107 4.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162619
AA Change: K52Q

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142743
Gene: ENSMUSG00000029334
AA Change: K52Q

DomainStartEndE-ValueType
Blast:S_TKc 1 43 8e-23 BLAST
S_TK_X 44 94 4.6e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Prkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Prkg2 APN 5 99024541 missense probably benign 0.00
IGL01063:Prkg2 APN 5 98969936 critical splice donor site probably null
IGL02060:Prkg2 APN 5 99024515 missense probably benign 0.32
IGL02666:Prkg2 APN 5 98997519 splice site probably benign
IGL02992:Prkg2 APN 5 99024506 missense probably benign
IGL03040:Prkg2 APN 5 98973107 critical splice donor site probably null
devito UTSW 5 98966510 critical splice donor site probably null
P0005:Prkg2 UTSW 5 98969947 missense probably damaging 1.00
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0115:Prkg2 UTSW 5 98994655 splice site probably null
R0403:Prkg2 UTSW 5 98994645 missense possibly damaging 0.95
R0452:Prkg2 UTSW 5 98997520 splice site probably benign
R0481:Prkg2 UTSW 5 98994655 splice site probably null
R1194:Prkg2 UTSW 5 98971926 missense probably benign 0.00
R1534:Prkg2 UTSW 5 98994561 missense probably damaging 1.00
R1861:Prkg2 UTSW 5 98947416 missense probably damaging 1.00
R2010:Prkg2 UTSW 5 99024805 missense probably benign
R2031:Prkg2 UTSW 5 99024451 missense possibly damaging 0.85
R2176:Prkg2 UTSW 5 98966509 splice site probably benign
R3607:Prkg2 UTSW 5 98947377 missense probably damaging 1.00
R3958:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R3960:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R4012:Prkg2 UTSW 5 98979815 missense possibly damaging 0.93
R4794:Prkg2 UTSW 5 98966633 missense probably damaging 1.00
R4840:Prkg2 UTSW 5 98981143 missense probably benign 0.03
R4867:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5182:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5226:Prkg2 UTSW 5 98976462 missense possibly damaging 0.92
R5274:Prkg2 UTSW 5 98969991 missense probably damaging 1.00
R5416:Prkg2 UTSW 5 98943467 missense probably benign 0.05
R5531:Prkg2 UTSW 5 98967734 missense probably damaging 1.00
R5619:Prkg2 UTSW 5 98988297 missense probably damaging 1.00
R6925:Prkg2 UTSW 5 98966510 critical splice donor site probably null
Z1088:Prkg2 UTSW 5 99024804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCCACACTATTTAAGTCTCTAG -3'
(R):5'- AATGGGTCAAGGCATCCTTCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- AAGGCATCCTTCCCTGTTAACTTCAG -3'
Posted On2018-03-15