Incidental Mutation 'R6264:Zfp354c'
ID506895
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Namezinc finger protein 354C
SynonymsAJ18, Kid3, 5330421P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50811086-50827724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50815447 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 267 (T267I)
Ref Sequence ENSEMBL: ENSMUSP00000104763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000109135]
Predicted Effect probably benign
Transcript: ENSMUST00000000632
AA Change: T267I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807
AA Change: T267I

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109135
AA Change: T267I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807
AA Change: T267I

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139465
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50815613 missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50817905 missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50817194 missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50815630 missense probably benign 0.12
R1370:Zfp354c UTSW 11 50815840 missense probably benign
R2109:Zfp354c UTSW 11 50817142 missense probably benign 0.01
R2850:Zfp354c UTSW 11 50815331 nonsense probably null
R4010:Zfp354c UTSW 11 50814944 missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50815039 missense probably benign 0.14
R5430:Zfp354c UTSW 11 50815195 missense probably benign 0.02
R5439:Zfp354c UTSW 11 50815770 missense probably benign 0.01
R5905:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R6244:Zfp354c UTSW 11 50814971 missense probably benign 0.41
R6591:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R6650:Zfp354c UTSW 11 50814691 missense probably damaging 1.00
R6691:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R7087:Zfp354c UTSW 11 50815213 missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50814656 missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R7619:Zfp354c UTSW 11 50817808 critical splice donor site probably null
R7710:Zfp354c UTSW 11 50815240 small deletion probably benign
R7712:Zfp354c UTSW 11 50815240 small deletion probably benign
R7747:Zfp354c UTSW 11 50815240 small deletion probably benign
R7748:Zfp354c UTSW 11 50815240 small deletion probably benign
R7784:Zfp354c UTSW 11 50815240 small deletion probably benign
R7816:Zfp354c UTSW 11 50815240 small deletion probably benign
R7817:Zfp354c UTSW 11 50815240 small deletion probably benign
R7853:Zfp354c UTSW 11 50815240 small deletion probably benign
R7855:Zfp354c UTSW 11 50815240 small deletion probably benign
R7870:Zfp354c UTSW 11 50815238 small deletion probably benign
R7936:Zfp354c UTSW 11 50815240 small deletion probably benign
R7938:Zfp354c UTSW 11 50815240 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACACGTGTAAAGGTTCTCCC -3'
(R):5'- CACTTCAGAGAAAGATTTACCACAGG -3'

Sequencing Primer
(F):5'- GCAGTTAAAGGCCTTGTCAC -3'
(R):5'- TGAGAAGCTTTCAAATGTACCCAGG -3'
Posted On2018-03-15