Incidental Mutation 'R6264:Ahsg'
ID506912
Institutional Source Beutler Lab
Gene Symbol Ahsg
Ensembl Gene ENSMUSG00000022868
Gene Namealpha-2-HS-glycoprotein
Synonymsfetuin-A
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location22891277-22899449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22898861 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 224 (D224G)
Ref Sequence ENSEMBL: ENSMUSP00000156233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023583] [ENSMUST00000231328] [ENSMUST00000231848] [ENSMUST00000231932] [ENSMUST00000232098] [ENSMUST00000232674]
Predicted Effect probably benign
Transcript: ENSMUST00000023583
AA Change: D275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023583
Gene: ENSMUSG00000022868
AA Change: D275G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 22 133 8.6e-24 SMART
CY 145 248 6.58e-20 SMART
low complexity region 273 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231328
AA Change: D231G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231692
Predicted Effect probably benign
Transcript: ENSMUST00000231848
AA Change: D224G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000231932
Predicted Effect probably benign
Transcript: ENSMUST00000232098
AA Change: D196G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232556
Predicted Effect probably benign
Transcript: ENSMUST00000232674
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha2-HS glycoprotein (AHSG), a glycoprotein present in the serum, is synthesized by hepatocytes. The AHSG molecule consists of two polypeptide chains, which are both cleaved from a proprotein encoded from a single mRNA. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. The protein is commonly present in the cortical plate of the immature cerebral cortex and bone marrow hemopoietic matrix, and it has therefore been postulated that it participates in the development of the tissues. However, its exact significance is still obscure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking this gene exhibit defective inhibition of serum apatite formation, sometimes causing muscle calcification. They are resistant to weight gain on a high-fat diet and have increased insulin sensitivity and glucose clearance and reduced fasting plasma free fatty acids and triglycerides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Ahsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01830:Ahsg APN 16 22899029 missense probably damaging 1.00
IGL01885:Ahsg APN 16 22898981 missense probably damaging 1.00
IGL02208:Ahsg APN 16 22892310 missense possibly damaging 0.89
IGL02593:Ahsg APN 16 22892328 critical splice donor site probably null
IGL03059:Ahsg APN 16 22899005 missense possibly damaging 0.57
R0257:Ahsg UTSW 16 22899040 missense probably benign
R0615:Ahsg UTSW 16 22899055 missense possibly damaging 0.92
R1829:Ahsg UTSW 16 22892328 unclassified probably benign
R5034:Ahsg UTSW 16 22898900 missense probably damaging 1.00
R5149:Ahsg UTSW 16 22898923 missense probably benign 0.02
R5670:Ahsg UTSW 16 22898163 missense probably benign
R6788:Ahsg UTSW 16 22894835 missense probably benign 0.01
R7026:Ahsg UTSW 16 22892213 missense probably damaging 1.00
R7027:Ahsg UTSW 16 22892257 missense probably damaging 0.99
X0060:Ahsg UTSW 16 22895262 missense probably damaging 1.00
Z1177:Ahsg UTSW 16 22899047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGCAGGTGAGACTGGCG -3'
(R):5'- TGAAGTGTCTGATCCTCCCTGG -3'

Sequencing Primer
(F):5'- TGAGACTGGCGCTCCATAG -3'
(R):5'- TGATCCTCCCTGGGCACATG -3'
Posted On2018-03-15