Incidental Mutation 'R6265:Gorab'
ID506921
Institutional Source Beutler Lab
Gene Symbol Gorab
Ensembl Gene ENSMUSG00000040124
Gene Namegolgin, RAB6-interacting
SynonymsNTKL-BP1, Scyl1bp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163384908-163403669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163386630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 244 (T244A)
Ref Sequence ENSEMBL: ENSMUSP00000036253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045138] [ENSMUST00000186402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045138
AA Change: T244A

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036253
Gene: ENSMUSG00000040124
AA Change: T244A

DomainStartEndE-ValueType
Pfam:Transcrip_act 128 276 9.3e-11 PFAM
low complexity region 277 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186402
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the golgin family, a group of coiled-coil proteins localized to the Golgi. The encoded protein may function in the secretory pathway. The encoded protein, which also localizes to the cytoplasm, was identified by interactions with the N-terminal kinase-like protein, and thus it may function in mitosis. Mutations in this gene have been associated with geroderma osteodysplastica. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null gene trap allele exhibit hunched posture, craniofacial abnormalities, neonatal lethality, respiratory distress, skin edema, decreased hair follicles, fewer dermal condensates and papillae, and impaired formation of primary cilia on dermal condensate cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Gorab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gorab APN 1 163394687 missense probably damaging 1.00
IGL00915:Gorab APN 1 163396857 missense probably benign 0.00
IGL01645:Gorab APN 1 163386431 missense possibly damaging 0.46
R0387:Gorab UTSW 1 163396834 missense probably benign 0.20
R0504:Gorab UTSW 1 163386605 missense probably damaging 1.00
R0612:Gorab UTSW 1 163397169 missense possibly damaging 0.93
R1863:Gorab UTSW 1 163403562 missense probably damaging 1.00
R1991:Gorab UTSW 1 163397056 missense probably damaging 0.99
R1992:Gorab UTSW 1 163397056 missense probably damaging 0.99
R2844:Gorab UTSW 1 163396806 splice site probably null
R4039:Gorab UTSW 1 163397066 missense possibly damaging 0.65
R4527:Gorab UTSW 1 163397136 missense possibly damaging 0.94
R4864:Gorab UTSW 1 163386398 missense probably benign
R5175:Gorab UTSW 1 163386645 missense probably damaging 1.00
R5470:Gorab UTSW 1 163392509 missense probably damaging 1.00
R5485:Gorab UTSW 1 163386302 missense possibly damaging 0.55
R6314:Gorab UTSW 1 163397089 missense probably damaging 1.00
R6355:Gorab UTSW 1 163386569 missense probably damaging 1.00
R7707:Gorab UTSW 1 163392440 missense probably damaging 1.00
Z1088:Gorab UTSW 1 163386323 missense possibly damaging 0.56
Z1088:Gorab UTSW 1 163403550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGAAGACACACTCTCGCC -3'
(R):5'- ACTTCTATAGCGTCATTGCATTGC -3'

Sequencing Primer
(F):5'- CTCTACAGAAGCCATTTGTTTGG -3'
(R):5'- ATAGCGTCATTGCATTGCATTTCG -3'
Posted On2018-03-15