Incidental Mutation 'R6265:Foxs1'
ID506924
Institutional Source Beutler Lab
Gene Symbol Foxs1
Ensembl Gene ENSMUSG00000074676
Gene Nameforkhead box S1
SynonymsFkh3, FREAC10, Fkhl18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152931898-152933208 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 152932178 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 318 (C318*)
Ref Sequence ENSEMBL: ENSMUSP00000096806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099200]
Predicted Effect probably null
Transcript: ENSMUST00000099200
AA Change: C318*
SMART Domains Protein: ENSMUSP00000096806
Gene: ENSMUSG00000074676
AA Change: C318*

DomainStartEndE-ValueType
FH 16 106 1.88e-60 SMART
low complexity region 269 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for one reporter allele display enhanced rotarod performance and increased male resistance to diet-induced obesity. Homozygotes for another reporter allele show impaired testicular vasculature, including blood accumulation in fetal testis and marked apoptosis of periendothelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Foxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Foxs1 APN 2 152932312 missense probably benign
IGL02304:Foxs1 APN 2 152932350 missense probably benign 0.01
IGL02491:Foxs1 APN 2 152932801 missense probably damaging 1.00
IGL03009:Foxs1 APN 2 152932929 missense probably damaging 1.00
IGL03046:Foxs1 UTSW 2 152932564 missense probably benign 0.00
R0158:Foxs1 UTSW 2 152932410 missense probably damaging 1.00
R0324:Foxs1 UTSW 2 152932687 missense probably benign 0.02
R1616:Foxs1 UTSW 2 152932639 missense probably benign 0.37
R1915:Foxs1 UTSW 2 152932840 missense probably damaging 0.99
R3113:Foxs1 UTSW 2 152932236 missense probably benign 0.00
R4885:Foxs1 UTSW 2 152932381 missense probably benign 0.00
R6084:Foxs1 UTSW 2 152932842 missense possibly damaging 0.81
R6720:Foxs1 UTSW 2 152932720 missense probably damaging 0.99
R6828:Foxs1 UTSW 2 152933128 nonsense probably null
R6845:Foxs1 UTSW 2 152932699 missense probably benign
R7456:Foxs1 UTSW 2 152933125 missense probably benign
R7577:Foxs1 UTSW 2 152932441 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCAAGTTTGTCAGGAGGC -3'
(R):5'- ATTTCTGTATGGGGACTGACC -3'

Sequencing Primer
(F):5'- TTTGTCAGGAGGCCCCCAAG -3'
(R):5'- GACTGACCCAGGCCTTGAAC -3'
Posted On2018-03-15