Incidental Mutation 'R6265:Lamtor2'
ID506926
Institutional Source Beutler Lab
Gene Symbol Lamtor2
Ensembl Gene ENSMUSG00000028062
Gene Namelate endosomal/lysosomal adaptor, MAPK and MTOR activator 2
SynonymsP14, 2010111E04Rik, Mapbpip, Robld3, Rab25
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88549819-88553074 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 88550713 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 29 (G29*)
Ref Sequence ENSEMBL: ENSMUSP00000112936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008745] [ENSMUST00000008748] [ENSMUST00000029698] [ENSMUST00000119002] [ENSMUST00000131775] [ENSMUST00000192962]
Predicted Effect probably benign
Transcript: ENSMUST00000008745
SMART Domains Protein: ENSMUSP00000008745
Gene: ENSMUSG00000008601

DomainStartEndE-ValueType
RAB 13 176 2.1e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000008748
SMART Domains Protein: ENSMUSP00000008748
Gene: ENSMUSG00000008604

DomainStartEndE-ValueType
UBQ 13 83 9.08e-17 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 130 149 N/A INTRINSIC
low complexity region 152 170 N/A INTRINSIC
low complexity region 176 185 N/A INTRINSIC
STI1 187 224 2.76e-6 SMART
STI1 225 256 2.39e-1 SMART
low complexity region 302 313 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
STI1 388 435 7.4e-7 SMART
STI1 439 471 3.21e1 SMART
low complexity region 528 539 N/A INTRINSIC
UBA 554 592 8.25e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000029698
AA Change: G102*
SMART Domains Protein: ENSMUSP00000029698
Gene: ENSMUSG00000028062
AA Change: G102*

DomainStartEndE-ValueType
Robl_LC7 7 95 2.65e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119002
AA Change: G29*
SMART Domains Protein: ENSMUSP00000112936
Gene: ENSMUSG00000028062
AA Change: G29*

DomainStartEndE-ValueType
Blast:Robl_LC7 1 22 2e-8 BLAST
PDB:3CPT|B 1 52 2e-32 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131775
SMART Domains Protein: ENSMUSP00000120505
Gene: ENSMUSG00000008601

DomainStartEndE-ValueType
RAB 3 122 6.15e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156421
Predicted Effect probably benign
Transcript: ENSMUST00000192962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The mouse protein interacts with MAPK scaffold protein 1, a component of the mitogen-activated protein kinase pathway. In humans, a mutation in this gene has been associated with a primary immunodeficiency syndrome, and suggests a role for this protein in endosomal biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele display severe developmental defects, are growth retarded and die prior to E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Lamtor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Blaze UTSW 3 88552856 missense possibly damaging 0.59
R5012:Lamtor2 UTSW 3 88552856 missense possibly damaging 0.59
R5678:Lamtor2 UTSW 3 88550794 unclassified probably benign
R6983:Lamtor2 UTSW 3 88552839 nonsense probably null
R7903:Lamtor2 UTSW 3 88552510 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAACTAAGGCTGGATCAGTGC -3'
(R):5'- GGAGACAATGTCACTAGGACC -3'

Sequencing Primer
(F):5'- AAATGCCGATTTCTGTGCCAG -3'
(R):5'- TGTCACTAGGACCAGAGGAACC -3'
Posted On2018-03-15