Incidental Mutation 'R6265:Cxxc4'
ID506927
Institutional Source Beutler Lab
Gene Symbol Cxxc4
Ensembl Gene ENSMUSG00000044365
Gene NameCXXC finger 4
Synonyms9330210J02Rik, C030003J12Rik, Idax
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location134236484-134262161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134258063 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 356 (V356A)
Ref Sequence ENSEMBL: ENSMUSP00000138000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166288] [ENSMUST00000181904]
Predicted Effect probably benign
Transcript: ENSMUST00000166288
AA Change: V188A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128574
Gene: ENSMUSG00000044365
AA Change: V188A

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Pfam:zf-CXXC 131 172 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181904
AA Change: V356A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138000
Gene: ENSMUSG00000044365
AA Change: V356A

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 165 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Pfam:zf-CXXC 299 340 5.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197151
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Cxxc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cxxc4 APN 3 134240659 missense probably null 0.99
R1839:Cxxc4 UTSW 3 134240653 missense probably damaging 1.00
R6744:Cxxc4 UTSW 3 134240130 small insertion probably benign
R6947:Cxxc4 UTSW 3 134240516 missense possibly damaging 0.90
R7764:Cxxc4 UTSW 3 134240095 missense unknown
R7842:Cxxc4 UTSW 3 134240332 missense possibly damaging 0.93
R7860:Cxxc4 UTSW 3 134258053 missense probably benign 0.21
R8845:Cxxc4 UTSW 3 134240151 small insertion probably benign
Z1177:Cxxc4 UTSW 3 134240050 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTCAGTCGTTAGGGTCAATC -3'
(R):5'- TGGCCAATTCCCCAAACTTC -3'

Sequencing Primer
(F):5'- CAGTCGTTAGGGTCAATCAATTAG -3'
(R):5'- CCAAACTTCCCTGTTAATTTTATGTG -3'
Posted On2018-03-15