Incidental Mutation 'R6265:Melk'
ID506928
Institutional Source Beutler Lab
Gene Symbol Melk
Ensembl Gene ENSMUSG00000035683
Gene Namematernal embryonic leucine zipper kinase
SynonymsMPK38
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44300876-44364675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44318109 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 170 (Y170C)
Ref Sequence ENSEMBL: ENSMUSP00000120242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045607] [ENSMUST00000125708] [ENSMUST00000137703]
Predicted Effect probably damaging
Transcript: ENSMUST00000045607
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043806
Gene: ENSMUSG00000035683
AA Change: Y218C

DomainStartEndE-ValueType
S_TKc 11 263 2.64e-105 SMART
low complexity region 313 325 N/A INTRINSIC
Pfam:KA1 599 643 2.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118668
Predicted Effect probably benign
Transcript: ENSMUST00000125708
SMART Domains Protein: ENSMUSP00000118359
Gene: ENSMUSG00000035683

DomainStartEndE-ValueType
Pfam:Pkinase 11 91 1.9e-15 PFAM
Pfam:Pkinase_Tyr 11 97 4.3e-10 PFAM
Pfam:Pkinase 88 134 6.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137703
AA Change: Y170C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120242
Gene: ENSMUSG00000035683
AA Change: Y170C

DomainStartEndE-ValueType
Pfam:Pkinase 11 88 7.7e-15 PFAM
Pfam:Pkinase_Tyr 11 88 3.1e-9 PFAM
Pfam:Pkinase_Tyr 87 212 1.5e-15 PFAM
Pfam:Pkinase 87 215 3.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137759
Meta Mutation Damage Score 0.7345 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for an allele that produces a kinase-dead protein exhibit altered pancreatic regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Melk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Melk APN 4 44347262 missense probably benign 0.05
IGL01367:Melk APN 4 44332907 missense possibly damaging 0.62
IGL01865:Melk APN 4 44344988 missense probably benign 0.00
IGL02801:Melk APN 4 44360930 missense probably damaging 0.99
R0037:Melk UTSW 4 44360864 splice site probably benign
R0433:Melk UTSW 4 44340614 splice site probably benign
R0570:Melk UTSW 4 44308906 missense probably damaging 1.00
R0786:Melk UTSW 4 44303649 missense unknown
R1483:Melk UTSW 4 44308937 missense probably damaging 1.00
R2042:Melk UTSW 4 44309051 critical splice donor site probably null
R3831:Melk UTSW 4 44345021 missense probably benign 0.05
R5060:Melk UTSW 4 44350959 missense probably benign 0.15
R5236:Melk UTSW 4 44344959 missense probably benign
R5269:Melk UTSW 4 44363730 missense probably damaging 1.00
R5357:Melk UTSW 4 44363730 missense probably damaging 1.00
R5358:Melk UTSW 4 44363730 missense probably damaging 1.00
R5360:Melk UTSW 4 44363730 missense probably damaging 1.00
R5430:Melk UTSW 4 44309033 missense probably damaging 1.00
R5576:Melk UTSW 4 44312255 missense probably null 1.00
R5656:Melk UTSW 4 44312237 missense possibly damaging 0.95
R5738:Melk UTSW 4 44310333 missense probably damaging 1.00
R5972:Melk UTSW 4 44351007 missense probably benign 0.01
R6340:Melk UTSW 4 44340633 missense probably damaging 1.00
R7202:Melk UTSW 4 44351106 missense probably benign
R7242:Melk UTSW 4 44360885 missense probably damaging 1.00
R7328:Melk UTSW 4 44332931 missense probably benign
R7608:Melk UTSW 4 44325571 splice site probably null
R8053:Melk UTSW 4 44318109 missense probably damaging 1.00
R8185:Melk UTSW 4 44360965 missense probably benign 0.14
R8356:Melk UTSW 4 44312191 missense possibly damaging 0.75
R8456:Melk UTSW 4 44312191 missense possibly damaging 0.75
X0020:Melk UTSW 4 44349876 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATTGAACGTCAGCAGGCCTTC -3'
(R):5'- ATGCAGGCTCCAACTATTTTCC -3'

Sequencing Primer
(F):5'- AGGCCTTCCATTGAGTCAGTGAC -3'
(R):5'- ATTTTCCCCTTAACCATGGCCAAAC -3'
Posted On2018-03-15