Incidental Mutation 'R6265:Ing3'
ID506938
Institutional Source Beutler Lab
Gene Symbol Ing3
Ensembl Gene ENSMUSG00000029670
Gene Nameinhibitor of growth family, member 3
Synonyms1300013A07Rik, P47ING3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location21949571-21976038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21953814 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 85 (Q85K)
Ref Sequence ENSEMBL: ENSMUSP00000031680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031680] [ENSMUST00000115389] [ENSMUST00000136200] [ENSMUST00000149728] [ENSMUST00000151473] [ENSMUST00000152877]
Predicted Effect probably damaging
Transcript: ENSMUST00000031680
AA Change: Q85K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031680
Gene: ENSMUSG00000029670
AA Change: Q85K

DomainStartEndE-ValueType
Pfam:ING 3 104 2.7e-31 PFAM
low complexity region 214 239 N/A INTRINSIC
low complexity region 308 345 N/A INTRINSIC
PHD 365 410 4e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115389
AA Change: Q85K

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111047
Gene: ENSMUSG00000029670
AA Change: Q85K

DomainStartEndE-ValueType
Pfam:ING 2 104 1.5e-33 PFAM
low complexity region 203 228 N/A INTRINSIC
low complexity region 297 334 N/A INTRINSIC
PHD 354 399 6.39e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136200
SMART Domains Protein: ENSMUSP00000138656
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 41 1.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144534
Predicted Effect possibly damaging
Transcript: ENSMUST00000149728
AA Change: Q70K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145391
Gene: ENSMUSG00000029670
AA Change: Q70K

DomainStartEndE-ValueType
Pfam:ING 1 89 6.8e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151473
AA Change: Q61K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120651
Gene: ENSMUSG00000029670
AA Change: Q61K

DomainStartEndE-ValueType
Pfam:ING 2 80 1.9e-19 PFAM
low complexity region 190 215 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152877
AA Change: Q85K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138244
Gene: ENSMUSG00000029670
AA Change: Q85K

DomainStartEndE-ValueType
Pfam:ING 2 89 1.5e-27 PFAM
Meta Mutation Damage Score 0.1545 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Ing3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Ing3 APN 6 21968880 splice site probably benign
IGL02330:Ing3 APN 6 21952121 missense probably benign 0.00
IGL02668:Ing3 APN 6 21950059 missense probably damaging 0.98
IGL02897:Ing3 APN 6 21969326 missense probably benign 0.14
IGL03065:Ing3 APN 6 21971222 missense probably benign
R0076:Ing3 UTSW 6 21952171 missense probably benign
R0513:Ing3 UTSW 6 21970035 missense probably damaging 0.98
R0711:Ing3 UTSW 6 21971237 nonsense probably null
R2369:Ing3 UTSW 6 21950091 missense probably damaging 0.98
R4660:Ing3 UTSW 6 21973711 utr 3 prime probably benign
R4672:Ing3 UTSW 6 21965730 splice site probably null
R5557:Ing3 UTSW 6 21968909 missense possibly damaging 0.95
R5682:Ing3 UTSW 6 21968950 missense probably damaging 0.98
R5773:Ing3 UTSW 6 21971835 missense probably damaging 1.00
R5774:Ing3 UTSW 6 21967689 missense probably benign
R5914:Ing3 UTSW 6 21968905 missense probably benign 0.18
R5976:Ing3 UTSW 6 21971174 missense probably benign 0.09
R7239:Ing3 UTSW 6 21952194 missense probably damaging 0.99
R7526:Ing3 UTSW 6 21953799 missense probably damaging 1.00
R8112:Ing3 UTSW 6 21952182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGTTATTGCTAATATGATGAGC -3'
(R):5'- TGTACAGTAGTCTTCACTGAGGTG -3'

Sequencing Primer
(F):5'- TGCTAATATGATGAGCAAGTGATAAC -3'
(R):5'- CTAAACTGTGAACGTCTATGACTC -3'
Posted On2018-03-15