Incidental Mutation 'R6265:Nlrp9b'
ID506945
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene NameNLR family, pyrin domain containing 9B
SynonymsNalp-delta, Nalp9b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19991465-20073306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20062683 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 986 (F986I)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909]
Predicted Effect probably benign
Transcript: ENSMUST00000073151
AA Change: F986I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: F986I

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117909
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 20023278 missense probably benign 0.43
IGL00675:Nlrp9b APN 7 20023186 missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 20023522 missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 20023537 missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 20023187 missense probably benign 0.06
IGL01464:Nlrp9b APN 7 20062655 missense probably benign 0.00
IGL01514:Nlrp9b APN 7 20045934 critical splice donor site probably null
IGL01731:Nlrp9b APN 7 20023417 nonsense probably null
IGL02427:Nlrp9b APN 7 20042501 missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 20048825 missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 20023722 missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 20024056 missense probably benign 0.00
R0276:Nlrp9b UTSW 7 20028498 missense probably benign 0.21
R0346:Nlrp9b UTSW 7 20024515 missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 20049450 missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 20023164 missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 20048847 nonsense probably null
R1648:Nlrp9b UTSW 7 20026544 missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 20028564 missense probably benign 0.01
R1903:Nlrp9b UTSW 7 20023257 missense probably benign 0.44
R2191:Nlrp9b UTSW 7 20023662 missense probably benign
R4572:Nlrp9b UTSW 7 20026681 critical splice donor site probably null
R4863:Nlrp9b UTSW 7 20049596 critical splice donor site probably null
R4939:Nlrp9b UTSW 7 20024496 missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 20049456 missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 20023991 missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 20023164 missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 20024492 missense probably benign 0.02
R6456:Nlrp9b UTSW 7 20048778 missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 20019338 missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 20023234 nonsense probably null
R6896:Nlrp9b UTSW 7 20023245 missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 20049508 missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 20045930 missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 20028456 missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 20049513 missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 20023950 missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 20045766 missense probably benign 0.04
X0064:Nlrp9b UTSW 7 20048758 missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 20023743 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGGACTGATGACAGAGTC -3'
(R):5'- AGCTGCTGAGAAAGACACCTAG -3'

Sequencing Primer
(F):5'- CTTAACATGTGTGCAGCAGC -3'
(R):5'- AGACACCTAGTGAAGACATGTTAC -3'
Posted On2018-03-15