Incidental Mutation 'R6265:Vmn2r61'
ID506947
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42266491 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 176 (I176T)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably benign
Transcript: ENSMUST00000166131
AA Change: I176T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: I176T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206855
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
R7839:Vmn2r61 UTSW 7 42266608 missense probably damaging 0.97
R7916:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R8026:Vmn2r61 UTSW 7 42266717 missense probably benign 0.02
R8440:Vmn2r61 UTSW 7 42266656 missense probably benign 0.02
R8499:Vmn2r61 UTSW 7 42300276 missense probably damaging 0.99
R8771:Vmn2r61 UTSW 7 42266770 missense probably damaging 0.99
R8847:Vmn2r61 UTSW 7 42300586 missense probably damaging 1.00
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 42260161 missense possibly damaging 0.46
Z1176:Vmn2r61 UTSW 7 42266742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATTGAAACTGGAGACAAGTCAGC -3'
(R):5'- GCATTCCATGTGCCAGAGATC -3'

Sequencing Primer
(F):5'- CTGGAGACAAGTCAGCAATTTTG -3'
(R):5'- AGGCTATGCAGATCCTATGACTC -3'
Posted On2018-03-15