Incidental Mutation 'R6265:Cars2'
ID506951
Institutional Source Beutler Lab
Gene Symbol Cars2
Ensembl Gene ENSMUSG00000056228
Gene Namecysteinyl-tRNA synthetase 2 (mitochondrial)(putative)
SynonymsD530030H10Rik, 2310051N18Rik, 2410044A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6265 (G1)
Quality Score156.468
Status Validated
Chromosome8
Chromosomal Location11513977-11550783 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCCC to TCCC at 11529599 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049461] [ENSMUST00000210478] [ENSMUST00000210599]
Predicted Effect probably null
Transcript: ENSMUST00000049461
SMART Domains Protein: ENSMUSP00000046453
Gene: ENSMUSG00000056228

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:tRNA-synt_1e 50 351 4.1e-116 PFAM
Pfam:tRNA-synt_1g 63 207 1.5e-7 PFAM
Pfam:tRNA-synt_1g 280 370 4.2e-7 PFAM
Blast:DALR_2 391 461 3e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209236
Predicted Effect probably benign
Transcript: ENSMUST00000210478
Predicted Effect probably benign
Transcript: ENSMUST00000210599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211406
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Cars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
madcow UTSW 8 11526034 missense probably damaging 1.00
PIT4810001:Cars2 UTSW 8 11514699 missense probably benign
R0633:Cars2 UTSW 8 11550511 missense probably benign 0.00
R0788:Cars2 UTSW 8 11529672 missense possibly damaging 0.76
R1493:Cars2 UTSW 8 11517817 critical splice donor site probably null
R1559:Cars2 UTSW 8 11530430 splice site probably null
R1846:Cars2 UTSW 8 11514674 missense probably benign 0.03
R1954:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1955:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1993:Cars2 UTSW 8 11514515 missense probably benign 0.03
R2062:Cars2 UTSW 8 11547747 missense probably damaging 1.00
R2153:Cars2 UTSW 8 11530299 missense possibly damaging 0.87
R5004:Cars2 UTSW 8 11518956 splice site probably null
R5320:Cars2 UTSW 8 11517854 missense probably benign 0.09
R6004:Cars2 UTSW 8 11547743 missense probably damaging 1.00
R6089:Cars2 UTSW 8 11530301 missense probably damaging 0.98
R6267:Cars2 UTSW 8 11529599 frame shift probably null
R6268:Cars2 UTSW 8 11529599 frame shift probably null
R6841:Cars2 UTSW 8 11516198 missense probably benign 0.01
R7076:Cars2 UTSW 8 11529649 missense probably damaging 1.00
R7586:Cars2 UTSW 8 11530321 nonsense probably null
R8342:Cars2 UTSW 8 11529706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTTACAGGCTGGAGTG -3'
(R):5'- ACATATTTTATAGCCTGAGGAGGG -3'

Sequencing Primer
(F):5'- TGGTATGGTCAGTATGGTAAGATAC -3'
(R):5'- CCTGAGGAGGGCTGCGG -3'
Posted On2018-03-15