Mutagenetix > Incidental Mutation

Incidental Mutation 'R6265:Col5a3'

506956

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R6265 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20770050-20815067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20793764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 730 (G730R)

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

unknown
Transcript: ENSMUST00000004201
AA Change: G730R

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: G730R

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145974

Meta Mutation Damage Score

0.9415

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (65/65)

MGI Phenotype

Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	C	T	4: 137,454,675	P47L	probably damaging	Het
Acot1	T	C	12: 84,016,913	I265T	probably benign	Het
Amotl1	T	C	9: 14,571,655	D587G	possibly damaging	Het
Anks1b	T	G	10: 90,941,500	D1117E	probably damaging	Het
Art4	T	G	6: 136,854,888	N85T	probably damaging	Het
Asb3	C	A	11: 31,085,143	Q462K	probably benign	Het
Atcay	C	T	10: 81,213,280	E163K	possibly damaging	Het
Atp6v0e	T	C	17: 26,676,533	V20A	possibly damaging	Het
Atp7b	G	A	8: 22,015,927	Q520*	probably null	Het
Baat	A	T	4: 49,502,836	D95E	possibly damaging	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Ccdc24	G	A	4: 117,871,177	Q47*	probably null	Het
Cep170b	C	A	12: 112,744,559	Q1488K	probably damaging	Het
Cldn24	A	C	8: 47,822,339	D66A	probably benign	Het
Cln5	C	A	14: 103,073,227	T110K	probably damaging	Het
Clvs2	C	A	10: 33,528,515	S235I	possibly damaging	Het
Crim1	C	T	17: 78,370,085	P905L	probably benign	Het
Cxxc4	T	C	3: 134,258,063	V356A	probably benign	Het
Dctn6	G	T	8: 34,094,903	N93K	probably damaging	Het
Dnah9	G	A	11: 66,168,094	A125V	probably benign	Het
Dnhd1	T	C	7: 105,693,370	I1307T	probably benign	Het
Dpy19l1	T	A	9: 24,432,371	I493F	possibly damaging	Het
Ebf2	A	G	14: 67,424,060	I546V	probably benign	Het
Fbll1	T	C	11: 35,797,809	E209G	probably damaging	Het
Foxj2	G	A	6: 122,828,174	A2T	probably damaging	Het
Foxs1	A	T	2: 152,932,178	C318*	probably null	Het
Gorab	T	C	1: 163,386,630	T244A	possibly damaging	Het
Gtsf1l	C	A	2: 163,087,663		probably benign	Het
Herc1	T	C	9: 66,372,016	S69P	probably benign	Het
Hpca	C	T	4: 129,118,652	W30*	probably null	Het
Ing3	C	A	6: 21,953,814	Q85K	probably damaging	Het
Klhdc8b	T	C	9: 108,448,425	E264G	probably damaging	Het
Lair1	T	A	7: 4,055,827		probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lamtor2	C	A	3: 88,550,713	G29*	probably null	Het
Loxhd1	A	T	18: 77,361,730	D341V	probably damaging	Het
Lrp2	T	A	2: 69,466,340	D3290V	probably damaging	Het
Matn2	A	T	15: 34,399,155	D396V	probably damaging	Het
Me3	T	A	7: 89,849,743	D510E	probably benign	Het
Melk	A	G	4: 44,318,109	Y170C	probably damaging	Het
Mgat2	T	C	12: 69,184,793	V47A	probably benign	Het
Mindy4	T	C	6: 55,301,064	I631T	probably damaging	Het
Myo5b	T	A	18: 74,577,440		probably null	Het
Myo7b	A	T	18: 31,998,150	D521E	probably damaging	Het
Nlrp9b	T	A	7: 20,062,683	F986I	probably benign	Het
Olfr1089	A	G	2: 86,732,955	L219P	probably damaging	Het
Patj	A	G	4: 98,469,567	D690G	probably benign	Het
Pias2	T	C	18: 77,097,258	S5P	probably damaging	Het
Reep4	A	T	14: 70,547,703	S150C	probably damaging	Het
Slc25a21	T	C	12: 57,196,900	R14G	probably benign	Het
Slc6a6	G	C	6: 91,754,915	R575T	probably damaging	Het
Speg	T	A	1: 75,406,679	Y886*	probably null	Het
Tas2r103	A	C	6: 133,036,531	F191V	probably damaging	Het
Tbc1d19	A	G	5: 53,837,924	D145G	probably benign	Het
Tex47	T	A	5: 7,305,461	I214N	probably damaging	Het
Tnnt3	A	T	7: 142,501,645	D3V	probably damaging	Het
Trdv2-1	T	G	14: 53,946,385	S24A	probably benign	Het
Ubr4	A	G	4: 139,452,640	D3377G	possibly damaging	Het
Ugt3a2	A	T	15: 9,361,579	D147V	probably damaging	Het
Usp9y	A	T	Y: 1,446,843	D103E	probably benign	Homo
Vmn1r168	A	G	7: 23,541,536	I273V	probably benign	Het
Vmn2r61	T	C	7: 42,266,491	I176T	probably benign	Het
Vmn2r8	T	A	5: 108,808,597	D53V	probably benign	Het
Zbtb8os	A	T	4: 129,335,982		probably benign	Het
Zfp551	C	T	7: 12,415,412	R690Q	probably damaging	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20786389	nonsense	probably null
IGL01548:Col5a3	APN	9	20803000	splice site	probably benign
IGL02164:Col5a3	APN	9	20792643	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20772154	missense	unknown
IGL02333:Col5a3	APN	9	20799306	missense	unknown
IGL02349:Col5a3	APN	9	20772361	missense	unknown
IGL02390:Col5a3	APN	9	20776996	missense	unknown
IGL02685:Col5a3	APN	9	20772205	missense	unknown
IGL02941:Col5a3	APN	9	20804666	missense	unknown
IGL03001:Col5a3	APN	9	20807744	missense	unknown
IGL03061:Col5a3	APN	9	20797572	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20804635	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20808379	missense	unknown
IGL03372:Col5a3	APN	9	20775328	missense	unknown
Guppy	UTSW	9	20779033	missense	probably damaging	1.00
minifish	UTSW	9	20785586	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20809856	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20777108	splice site	probably benign
R0316:Col5a3	UTSW	9	20775325	missense	unknown
R0357:Col5a3	UTSW	9	20807768	splice site	probably benign
R0360:Col5a3	UTSW	9	20772466	missense	unknown
R0483:Col5a3	UTSW	9	20782481	splice site	probably null
R0485:Col5a3	UTSW	9	20782708	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20775485	missense	unknown
R1035:Col5a3	UTSW	9	20793499	splice site	probably benign
R1051:Col5a3	UTSW	9	20775235	missense	unknown
R1295:Col5a3	UTSW	9	20808418	missense	unknown
R1438:Col5a3	UTSW	9	20779957	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20772220	missense	unknown
R1668:Col5a3	UTSW	9	20771096	missense	unknown
R1680:Col5a3	UTSW	9	20784668	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20809777	missense	unknown
R2149:Col5a3	UTSW	9	20771270	missense	unknown
R2159:Col5a3	UTSW	9	20771310	missense	unknown
R2939:Col5a3	UTSW	9	20795658	missense	unknown
R3236:Col5a3	UTSW	9	20807653	missense	unknown
R3845:Col5a3	UTSW	9	20808377	missense	unknown
R4598:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20814896	unclassified	probably benign
R4713:Col5a3	UTSW	9	20793574	missense	unknown
R4723:Col5a3	UTSW	9	20809591	missense	unknown
R5209:Col5a3	UTSW	9	20778643	intron	probably benign
R5336:Col5a3	UTSW	9	20799301	missense	unknown
R5378:Col5a3	UTSW	9	20797576	missense	unknown
R5614:Col5a3	UTSW	9	20783476	splice site	probably benign
R5775:Col5a3	UTSW	9	20801072	missense	unknown
R5895:Col5a3	UTSW	9	20772442	missense	unknown
R6048:Col5a3	UTSW	9	20807619	missense	unknown
R6372:Col5a3	UTSW	9	20785586	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20774052	missense	unknown
R6558:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20774019	missense	unknown
R6679:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20775035	missense	unknown
R6712:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20798452	missense	unknown
R7343:Col5a3	UTSW	9	20793946	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20770835	makesense	probably null
R7500:Col5a3	UTSW	9	20800289	missense	unknown
R7592:Col5a3	UTSW	9	20797393	missense	unknown
R7671:Col5a3	UTSW	9	20775086	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20774051	missense	unknown
R8510:Col5a3	UTSW	9	20793732	missense	unknown
R8979:Col5a3	UTSW	9	20775301	missense	unknown
R9050:Col5a3	UTSW	9	20786395	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20799437	missense	unknown
R9072:Col5a3	UTSW	9	20771157	missense	unknown
R9341:Col5a3	UTSW	9	20793613	missense	unknown
R9343:Col5a3	UTSW	9	20793613	missense	unknown
R9529:Col5a3	UTSW	9	20774012	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20803133	missense	unknown
R9781:Col5a3	UTSW	9	20809976	missense	unknown
Z1177:Col5a3	UTSW	9	20775334	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGCAAGTGGACCATGCAAATC -3'
(R):5'- CCTTTAGCAGGGAAGGAGACTG -3'

Sequencing Primer
(F):5'- GTGGACCATGCAAATCACCTTCTC -3'
(R):5'- TACCTCTGGTAACCGGGGTCTC -3'

Posted On

2018-03-15