Incidental Mutation 'R6265:Mgat2'
ID506967
Institutional Source Beutler Lab
Gene Symbol Mgat2
Ensembl Gene ENSMUSG00000043998
Gene Namemannoside acetylglucosaminyltransferase 2
SynonymsCDGS2, GNT-II, GNT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69184157-69186770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69184793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000057905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000054544] [ENSMUST00000060579] [ENSMUST00000110619] [ENSMUST00000110620]
Predicted Effect probably benign
Transcript: ENSMUST00000021356
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054544
SMART Domains Protein: ENSMUSP00000059766
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 94 6.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060579
AA Change: V47A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057905
Gene: ENSMUSG00000043998
AA Change: V47A

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:MGAT2 87 435 2.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110619
SMART Domains Protein: ENSMUSP00000106249
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 95 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110620
SMART Domains Protein: ENSMUSP00000106250
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 95 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a Golgi enzyme catalyzing an essential step in the conversion of oligomannose to complex N-glycans. The enzyme has the typical glycosyltransferase domains: a short N-terminal cytoplasmic domain, a hydrophobic non-cleavable signal-anchor domain, and a C-terminal catalytic domain. Mutations in this gene may lead to carbohydrate-deficient glycoprotein syndrome, type II. The coding region of this gene is intronless. Transcript variants with a spliced 5' UTR may exist, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice recapitulate aspects of the phenotype exhibited by patients with congenital disorders of glycosylation (CDG), particularly type IIa. Most null mice died either embyronically or postnataly and exhibited muscular, gastrointestinal, hematologic, and osteogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Mgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Mgat2 APN 12 69185641 missense probably damaging 0.99
IGL02428:Mgat2 APN 12 69184784 missense probably benign 0.45
IGL03064:Mgat2 APN 12 69185003 missense probably damaging 1.00
R0554:Mgat2 UTSW 12 69185392 missense probably benign
R1698:Mgat2 UTSW 12 69185719 missense probably benign
R1759:Mgat2 UTSW 12 69185527 missense probably benign 0.11
R2130:Mgat2 UTSW 12 69185294 missense probably damaging 1.00
R5982:Mgat2 UTSW 12 69185680 missense probably damaging 1.00
R5986:Mgat2 UTSW 12 69185384 missense probably benign 0.10
R6699:Mgat2 UTSW 12 69184781 missense probably damaging 0.99
R6841:Mgat2 UTSW 12 69185633 missense probably damaging 0.99
R7692:Mgat2 UTSW 12 69184670 missense probably damaging 1.00
R8005:Mgat2 UTSW 12 69185948 missense probably damaging 1.00
X0026:Mgat2 UTSW 12 69185107 missense probably damaging 1.00
X0060:Mgat2 UTSW 12 69185326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACTGCCAGAGAGGATG -3'
(R):5'- GTATTCCGGCCTGTTATGCACC -3'

Sequencing Primer
(F):5'- AGCCCGGGATGAGTTAGC -3'
(R):5'- AGGTGCCGTCATTACCGAC -3'
Posted On2018-03-15