Incidental Mutation 'R6265:Pias2'
ID506981
Institutional Source Beutler Lab
Gene Symbol Pias2
Ensembl Gene ENSMUSG00000025423
Gene Nameprotein inhibitor of activated STAT 2
SynonymsARIP3, Miz1, PIASxalpha, PIASxbeta, Dib, 6330408K17Rik, PIASxb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77065208-77155708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77097258 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 5 (S5P)
Ref Sequence ENSEMBL: ENSMUSP00000110424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114776] [ENSMUST00000114777] [ENSMUST00000168882]
Predicted Effect probably damaging
Transcript: ENSMUST00000114776
AA Change: S5P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110424
Gene: ENSMUSG00000025423
AA Change: S5P

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 7e-45 PFAM
Pfam:zf-MIZ 335 384 4.9e-24 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114777
AA Change: S12P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110425
Gene: ENSMUSG00000025423
AA Change: S12P

DomainStartEndE-ValueType
SAP 11 45 2.01e-5 SMART
low complexity region 102 117 N/A INTRINSIC
low complexity region 135 144 N/A INTRINSIC
Pfam:PINIT 145 297 4.8e-38 PFAM
Pfam:zf-MIZ 342 391 1.7e-24 PFAM
low complexity region 475 483 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 571 610 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168882
AA Change: S5P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131485
Gene: ENSMUSG00000025423
AA Change: S5P

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 2.3e-44 PFAM
Pfam:zf-MIZ 335 384 2.6e-23 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
low complexity region 564 603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Isoforms of the encoded protein enhance the sumoylation of specific target proteins including the p53 tumor suppressor protein, c-Jun, and the androgen receptor. A pseudogene of this gene is located on the short arm of chromosome 4. The symbol MIZ1 has also been associated with ZBTB17 which is a different gene located on chromosome 1. [provided by RefSeq, Aug 2011]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype although abnormalities are reported in the testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Pias2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Pias2 APN 18 77133211 missense probably damaging 1.00
IGL01105:Pias2 APN 18 77133156 missense probably damaging 1.00
IGL02379:Pias2 APN 18 77145148 splice site probably benign
IGL02932:Pias2 APN 18 77145103 missense probably damaging 1.00
IGL03181:Pias2 APN 18 77133242 missense possibly damaging 0.83
IGL03389:Pias2 APN 18 77097658 missense probably damaging 1.00
IGL03138:Pias2 UTSW 18 77150100 critical splice donor site probably null
R0492:Pias2 UTSW 18 77105885 missense probably damaging 1.00
R0577:Pias2 UTSW 18 77097281 missense probably damaging 1.00
R1660:Pias2 UTSW 18 77120129 missense probably damaging 1.00
R1866:Pias2 UTSW 18 77152716 missense probably benign 0.03
R1901:Pias2 UTSW 18 77097443 nonsense probably null
R1996:Pias2 UTSW 18 77129063 critical splice donor site probably null
R2107:Pias2 UTSW 18 77097471 missense probably benign 0.35
R4439:Pias2 UTSW 18 77097703 missense probably damaging 1.00
R4603:Pias2 UTSW 18 77130107 missense probably damaging 0.99
R4747:Pias2 UTSW 18 77152792 makesense probably null
R4816:Pias2 UTSW 18 77105891 critical splice donor site probably null
R5697:Pias2 UTSW 18 77133188 missense probably damaging 1.00
R6375:Pias2 UTSW 18 77152670 missense possibly damaging 0.96
R6545:Pias2 UTSW 18 77130085 missense possibly damaging 0.61
R6713:Pias2 UTSW 18 77065720 splice site probably null
R7193:Pias2 UTSW 18 77120121 missense possibly damaging 0.76
R7232:Pias2 UTSW 18 77133235 missense probably benign 0.02
R7253:Pias2 UTSW 18 77120115 missense probably damaging 0.97
R7259:Pias2 UTSW 18 77152720 missense possibly damaging 0.73
R8018:Pias2 UTSW 18 77128958 missense probably benign 0.00
R8534:Pias2 UTSW 18 77097387 missense possibly damaging 0.68
R8879:Pias2 UTSW 18 77146768 nonsense probably null
X0009:Pias2 UTSW 18 77145097 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGACAGTAAAGTGGTTAGTATACG -3'
(R):5'- TTCAAGTGTCCGTGGGTATC -3'

Sequencing Primer
(F):5'- ACGAACCAAGACTAGTTTCTAAAATG -3'
(R):5'- GGTATCGGCGTCTATATAATTCTCG -3'
Posted On2018-03-15