Incidental Mutation 'R6266:March4'
ID506985
Institutional Source Beutler Lab
Gene Symbol March4
Ensembl Gene ENSMUSG00000039372
Gene Namemembrane-associated ring finger (C3HC4) 4
Synonyms
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72427112-72536930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72452488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 208 (Y208C)
Ref Sequence ENSEMBL: ENSMUSP00000042803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047786]
Predicted Effect probably damaging
Transcript: ENSMUST00000047786
AA Change: Y208C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042803
Gene: ENSMUSG00000039372
AA Change: Y208C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 125 135 N/A INTRINSIC
RINGv 161 208 3.5e-18 SMART
transmembrane domain 235 257 N/A INTRINSIC
Blast:AAA 263 290 4e-9 BLAST
low complexity region 344 360 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH4 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH4 reduces surface accumulation of several membrane glycoproteins by directing them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in March4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:March4 APN 1 72452531 nonsense probably null
IGL02996:March4 APN 1 72428899 nonsense probably null
R0245:March4 UTSW 1 72534781 missense probably benign 0.00
R2865:March4 UTSW 1 72452575 missense probably damaging 1.00
R4386:March4 UTSW 1 72428814 missense probably benign 0.00
R4917:March4 UTSW 1 72428779 missense probably benign 0.27
R4918:March4 UTSW 1 72428779 missense probably benign 0.27
R5812:March4 UTSW 1 72428917 missense probably benign
R7247:March4 UTSW 1 72452478 nonsense probably null
R7619:March4 UTSW 1 72534989 missense possibly damaging 0.89
R7643:March4 UTSW 1 72447220 missense probably damaging 1.00
R8176:March4 UTSW 1 72534839 missense probably damaging 0.96
Z1176:March4 UTSW 1 72452500 missense probably damaging 1.00
Z1177:March4 UTSW 1 72428957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAAAGACCGCCTTTCAC -3'
(R):5'- GGCTATCAGAGTGGCTAAGAC -3'

Sequencing Primer
(F):5'- ACCACCTCCTGACTGTGTGG -3'
(R):5'- CCAGCCATGTCTCATCAA -3'
Posted On2018-03-15