Incidental Mutation 'R6266:Cecr2'
ID507000
Institutional Source Beutler Lab
Gene Symbol Cecr2
Ensembl Gene ENSMUSG00000071226
Gene NameCECR2, histone acetyl-lysine reader
SynonymsGtl4, 2610101O16Rik, 2810409N01Rik
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location120666369-120771190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120761686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1097 (S1097G)
Ref Sequence ENSEMBL: ENSMUSP00000108306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686]
Predicted Effect probably benign
Transcript: ENSMUST00000100993
AA Change: S1125G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: S1125G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:WHIM3 244 284 5.2e-11 PFAM
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 781 796 N/A INTRINSIC
low complexity region 839 855 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
low complexity region 1202 1223 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112686
AA Change: S1097G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: S1097G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 862 879 N/A INTRINSIC
low complexity region 1145 1159 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000143563
AA Change: S347G
SMART Domains Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226
AA Change: S347G

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 114 131 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Cecr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cecr2 APN 6 120756717 missense probably damaging 1.00
IGL00782:Cecr2 APN 6 120761621 missense probably benign 0.00
IGL01137:Cecr2 APN 6 120762028 missense probably damaging 1.00
IGL01446:Cecr2 APN 6 120758599 missense probably benign
IGL02108:Cecr2 APN 6 120762558 critical splice donor site probably null
IGL02195:Cecr2 APN 6 120731406 missense probably damaging 1.00
IGL02689:Cecr2 APN 6 120762167 missense probably damaging 1.00
IGL03189:Cecr2 APN 6 120762430 missense probably benign 0.13
PIT1430001:Cecr2 UTSW 6 120758479 missense probably benign 0.01
R0200:Cecr2 UTSW 6 120761797 missense probably damaging 1.00
R0586:Cecr2 UTSW 6 120757884 missense probably damaging 1.00
R0715:Cecr2 UTSW 6 120758198 missense probably benign 0.21
R0784:Cecr2 UTSW 6 120758149 missense possibly damaging 0.74
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1343:Cecr2 UTSW 6 120754711 missense probably damaging 0.99
R1349:Cecr2 UTSW 6 120757603 missense probably damaging 0.99
R1386:Cecr2 UTSW 6 120762131 missense probably damaging 1.00
R1438:Cecr2 UTSW 6 120761472 nonsense probably null
R1602:Cecr2 UTSW 6 120755587 missense possibly damaging 0.52
R1664:Cecr2 UTSW 6 120762026 missense probably damaging 0.96
R1731:Cecr2 UTSW 6 120758180 missense possibly damaging 0.74
R1817:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1818:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1819:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1862:Cecr2 UTSW 6 120757941 missense probably damaging 1.00
R1907:Cecr2 UTSW 6 120761160 missense probably benign 0.03
R1911:Cecr2 UTSW 6 120762565 unclassified probably benign
R2135:Cecr2 UTSW 6 120720962 missense probably damaging 1.00
R2273:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R2275:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R3713:Cecr2 UTSW 6 120758260 missense probably damaging 1.00
R4271:Cecr2 UTSW 6 120762475 missense probably damaging 1.00
R4706:Cecr2 UTSW 6 120755578 missense possibly damaging 0.73
R4873:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R4875:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R5137:Cecr2 UTSW 6 120755517 missense probably benign
R5153:Cecr2 UTSW 6 120734560 missense probably benign 0.03
R5377:Cecr2 UTSW 6 120756569 missense possibly damaging 0.87
R5598:Cecr2 UTSW 6 120731446 splice site probably null
R5651:Cecr2 UTSW 6 120755560 missense probably damaging 0.96
R5680:Cecr2 UTSW 6 120761426 missense probably benign
R5813:Cecr2 UTSW 6 120762208 missense probably damaging 0.99
R5970:Cecr2 UTSW 6 120720907 missense probably damaging 0.98
R6255:Cecr2 UTSW 6 120758050 missense probably damaging 1.00
R6630:Cecr2 UTSW 6 120762178 missense probably damaging 1.00
R6737:Cecr2 UTSW 6 120737123 missense possibly damaging 0.86
R6754:Cecr2 UTSW 6 120757578 missense probably damaging 0.98
R6807:Cecr2 UTSW 6 120734542 intron probably null
R7187:Cecr2 UTSW 6 120756686 missense probably benign
R7256:Cecr2 UTSW 6 120762529 missense probably benign
R7282:Cecr2 UTSW 6 120761621 missense
R7548:Cecr2 UTSW 6 120761714 missense
R7596:Cecr2 UTSW 6 120762206 missense probably benign
R7802:Cecr2 UTSW 6 120743847 missense probably benign 0.45
X0012:Cecr2 UTSW 6 120733774 missense probably damaging 0.99
X0063:Cecr2 UTSW 6 120762071 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCAGAAAAGCCACTCTGCC -3'
(R):5'- TCAGAAAAGCCCTGTGGAC -3'

Sequencing Primer
(F):5'- TCTGCCCCAGGGGTAAAACATTG -3'
(R):5'- CCTGTGGACATGTATAATAAGGAGTC -3'
Posted On2018-03-15