Mutagenetix > Incidental Mutations

Incidental Mutation 'R6266:Cecr2'

507000

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

044378-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6266 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120761686 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1097 (S1097G)

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686]

Predicted Effect

probably benign
Transcript: ENSMUST00000100993
AA Change: S1125G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: S1125G

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112686
AA Change: S1097G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: S1097G

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000143563
AA Change: S347G

SMART Domains

Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226
AA Change: S347G

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	63	79	N/A	INTRINSIC
low complexity region	114	131	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,742,312	V147I	probably benign	Het
2310035C23Rik	T	G	1: 105,731,282		probably null	Het
Akr1c12	T	C	13: 4,270,207	T295A	probably benign	Het
Aldh2	C	A	5: 121,568,934	V217L	probably damaging	Het
Arap3	G	A	18: 37,990,791	R392C	probably damaging	Het
Aurkaip1	T	G	4: 155,832,520	L75R	probably damaging	Het
Blm	C	A	7: 80,499,940	K640N	probably benign	Het
Brap	A	T	5: 121,685,265	T487S	probably benign	Het
Ccser2	G	A	14: 36,879,675	P276L	probably damaging	Het
Cdc42bpg	A	G	19: 6,311,473	E343G	probably damaging	Het
D7Ertd443e	A	T	7: 134,349,785	V53D	probably damaging	Het
Ddx3y	G	A	Y: 1,266,635	T274I	probably damaging	Homo
Dnah5	T	A	15: 28,335,627	F2246L	possibly damaging	Het
Dock3	T	A	9: 106,964,753	H959L	probably damaging	Het
Dpy19l1	A	G	9: 24,439,146	S406P	probably damaging	Het
Efcab8	T	C	2: 153,783,768	L116P	probably damaging	Het
Efnb2	T	C	8: 8,660,524	I31V	probably benign	Het
Fbxl12	A	T	9: 20,638,615	L271Q	probably damaging	Het
Fmn1	T	A	2: 113,596,338	N1133K	probably damaging	Het
Frmpd2	T	C	14: 33,565,907	S1219P	probably benign	Het
Gm7298	A	T	6: 121,782,704	R1187S	probably damaging	Het
H6pd	T	C	4: 149,995,957	I136V	probably benign	Het
Hyal2	A	G	9: 107,570,715	N189S	probably benign	Het
Jmjd1c	C	T	10: 67,249,660	P2410S	probably damaging	Het
Larp1	A	G	11: 58,042,263	D231G	probably damaging	Het
Lilra5	T	A	7: 4,241,928	S233T	possibly damaging	Het
Lrrc43	T	C	5: 123,503,277	F508S	probably damaging	Het
Marc2	T	C	1: 184,833,943	R85G	probably damaging	Het
March4	T	C	1: 72,452,488	Y208C	probably damaging	Het
Nr1h2	A	T	7: 44,552,052	C45*	probably null	Het
Olfr1123	T	A	2: 87,419,006	S319R	probably benign	Het
Olfr138	A	G	17: 38,275,148	I126V	probably benign	Het
Ppp2r5d	G	T	17: 46,685,703		probably null	Het
Prpf40a	A	T	2: 53,156,627	S324T	probably benign	Het
Psmb7	T	C	2: 38,640,187	D94G	probably damaging	Het
Psmd11	A	G	11: 80,445,941	T140A	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rbp3	G	A	14: 33,954,461	R122H	probably benign	Het
Rrp8	T	C	7: 105,736,389	E3G	probably damaging	Het
Sacm1l	T	C	9: 123,542,420	S37P	probably damaging	Het
Slc12a3	A	G	8: 94,358,471	R939G	possibly damaging	Het
Slc20a1	T	C	2: 129,209,894	S608P	possibly damaging	Het
Sntg1	T	C	1: 8,554,729	Q281R	possibly damaging	Het
Tefm	A	G	11: 80,137,988	L194P	probably damaging	Het
Terf2ip	T	A	8: 112,011,915	V145E	probably damaging	Het
Tmem231	T	A	8: 111,915,265	E219V	probably null	Het
Tmx3	T	A	18: 90,537,210		probably null	Het
Tns3	G	A	11: 8,492,987	P459S	probably damaging	Het
Trav13d-1	T	A	14: 52,851,763	S76R	probably benign	Het
Trp63	A	G	16: 25,862,460	N254S	probably damaging	Het
Tsen34	A	G	7: 3,693,985		probably benign	Het
Unc13d	A	G	11: 116,068,238	V701A	probably damaging	Het
Usp36	A	G	11: 118,268,585	S513P	probably damaging	Het
Uspl1	T	A	5: 149,204,366	S392T	probably damaging	Het
Vmn2r102	T	A	17: 19,678,745	C450S	probably benign	Het
Zfp128	T	C	7: 12,890,970	Y422H	possibly damaging	Het
Zkscan7	C	T	9: 122,895,234	Q423*	probably null	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	splice site	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
R8112:Cecr2	UTSW	6	120762214	missense	probably benign	0.00
R8289:Cecr2	UTSW	6	120758116	missense	probably benign	0.24
R8294:Cecr2	UTSW	6	120733786	missense	probably damaging	0.99
R8470:Cecr2	UTSW	6	120756933	missense	probably benign	0.21
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCAGAAAAGCCACTCTGCC -3'
(R):5'- TCAGAAAAGCCCTGTGGAC -3'

Sequencing Primer
(F):5'- TCTGCCCCAGGGGTAAAACATTG -3'
(R):5'- CCTGTGGACATGTATAATAAGGAGTC -3'

Posted On

2018-03-15