Incidental Mutation 'R6266:Nr1h2'
ID507005
Institutional Source Beutler Lab
Gene Symbol Nr1h2
Ensembl Gene ENSMUSG00000060601
Gene Namenuclear receptor subfamily 1, group H, member 2
SynonymsRIP15, LXRB, Unr2, LXRbeta
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44549616-44553951 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44552052 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 45 (C45*)
Ref Sequence ENSEMBL: ENSMUSP00000146826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000073488] [ENSMUST00000107910] [ENSMUST00000107911] [ENSMUST00000107912] [ENSMUST00000128600] [ENSMUST00000142298] [ENSMUST00000145956] [ENSMUST00000151793] [ENSMUST00000167197] [ENSMUST00000207737] [ENSMUST00000208366] [ENSMUST00000209017]
Predicted Effect probably benign
Transcript: ENSMUST00000049343
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073488
AA Change: C116*
SMART Domains Protein: ENSMUSP00000073188
Gene: ENSMUSG00000060601
AA Change: C116*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107910
AA Change: C113*
SMART Domains Protein: ENSMUSP00000103543
Gene: ENSMUSG00000060601
AA Change: C113*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107911
AA Change: C113*
SMART Domains Protein: ENSMUSP00000103544
Gene: ENSMUSG00000060601
AA Change: C113*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107912
AA Change: C116*
SMART Domains Protein: ENSMUSP00000103545
Gene: ENSMUSG00000060601
AA Change: C116*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128354
Predicted Effect probably benign
Transcript: ENSMUST00000128600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141901
Predicted Effect probably benign
Transcript: ENSMUST00000142298
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151793
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167197
AA Change: C116*
SMART Domains Protein: ENSMUSP00000126788
Gene: ENSMUSG00000060601
AA Change: C116*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207550
Predicted Effect probably benign
Transcript: ENSMUST00000207737
Predicted Effect probably null
Transcript: ENSMUST00000208322
AA Change: C64*
Predicted Effect probably null
Transcript: ENSMUST00000208366
AA Change: C116*
Predicted Effect probably null
Transcript: ENSMUST00000209017
AA Change: C45*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mutations cause altered lipid, cholesterol and glucose metabolism and may lead to elevated cartilage matrix catabolism and PGE2 production, lipid-laden uterus myocytes and Sertoli cells, impaired uterus contractility and parturition, and higher susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Nr1h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Nr1h2 APN 7 44550460 missense probably damaging 1.00
IGL02327:Nr1h2 APN 7 44551500 unclassified probably benign
bisogno UTSW 7 44550013 missense probably damaging 1.00
quiero UTSW 7 44552537 missense probably benign 0.27
R0179:Nr1h2 UTSW 7 44552265 intron probably null
R0433:Nr1h2 UTSW 7 44549987 makesense probably null
R0597:Nr1h2 UTSW 7 44552260 intron probably benign
R2432:Nr1h2 UTSW 7 44551367 missense possibly damaging 0.46
R4635:Nr1h2 UTSW 7 44552537 missense probably benign 0.27
R4662:Nr1h2 UTSW 7 44550431 missense probably damaging 1.00
R4675:Nr1h2 UTSW 7 44552555 missense possibly damaging 0.66
R4782:Nr1h2 UTSW 7 44550499 missense possibly damaging 0.93
R5064:Nr1h2 UTSW 7 44551649 missense possibly damaging 0.82
R5191:Nr1h2 UTSW 7 44550416 missense probably damaging 1.00
R6933:Nr1h2 UTSW 7 44550013 missense probably damaging 1.00
R7323:Nr1h2 UTSW 7 44550322 missense possibly damaging 0.65
R7577:Nr1h2 UTSW 7 44550792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATCATCAGCTCCTGAG -3'
(R):5'- TTAGAGCCAGAGGATGAGCC -3'

Sequencing Primer
(F):5'- TTGCTTCCGAAGTGCCAG -3'
(R):5'- CTTCCACTACAACGTGCT -3'
Posted On2018-03-15