Incidental Mutation 'R6266:Dock3'
ID507015
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106964753 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 959 (H959L)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: H959L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: H959L

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165075
AA Change: H45L
SMART Domains Protein: ENSMUSP00000130873
Gene: ENSMUSG00000039716
AA Change: H45L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Squeeze UTSW 9 106930043 missense probably damaging 1.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
R7357:Dock3 UTSW 9 107005369 missense probably benign 0.34
R7423:Dock3 UTSW 9 106967171 missense probably damaging 0.98
R7426:Dock3 UTSW 9 106895583 missense probably benign
R7439:Dock3 UTSW 9 107023732 missense probably damaging 1.00
R7452:Dock3 UTSW 9 106989465 missense probably damaging 1.00
R7470:Dock3 UTSW 9 107005445 missense probably damaging 1.00
R7879:Dock3 UTSW 9 106908501 missense probably benign 0.05
R7962:Dock3 UTSW 9 106908501 missense probably benign 0.05
R8047:Dock3 UTSW 9 106993009 missense possibly damaging 0.93
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGGTACTGCCAGATTTCCAC -3'
(R):5'- TTTGGGGCCATCTCAAACCC -3'

Sequencing Primer
(F):5'- GTATAAACTGGGCTGCTGAATCC -3'
(R):5'- GGCCATCTCAAACCCTCCCTTC -3'
Posted On2018-03-15