Mutagenetix > Incidental Mutation

Incidental Mutation 'R6266:Usp36'

507025

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

044378-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6266 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118268585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 513 (S513P)

Ref Sequence

ENSEMBL: ENSMUSP00000122761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000092382
AA Change: S678P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: S678P

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106296
AA Change: S678P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: S678P

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141647

Predicted Effect

probably damaging
Transcript: ENSMUST00000144153
AA Change: S513P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: S513P

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,742,312	V147I	probably benign	Het
2310035C23Rik	T	G	1: 105,731,282		probably null	Het
Akr1c12	T	C	13: 4,270,207	T295A	probably benign	Het
Aldh2	C	A	5: 121,568,934	V217L	probably damaging	Het
Arap3	G	A	18: 37,990,791	R392C	probably damaging	Het
Aurkaip1	T	G	4: 155,832,520	L75R	probably damaging	Het
Blm	C	A	7: 80,499,940	K640N	probably benign	Het
Brap	A	T	5: 121,685,265	T487S	probably benign	Het
Ccser2	G	A	14: 36,879,675	P276L	probably damaging	Het
Cdc42bpg	A	G	19: 6,311,473	E343G	probably damaging	Het
Cecr2	A	G	6: 120,761,686	S1097G	probably benign	Het
D7Ertd443e	A	T	7: 134,349,785	V53D	probably damaging	Het
Ddx3y	G	A	Y: 1,266,635	T274I	probably damaging	Homo
Dnah5	T	A	15: 28,335,627	F2246L	possibly damaging	Het
Dock3	T	A	9: 106,964,753	H959L	probably damaging	Het
Dpy19l1	A	G	9: 24,439,146	S406P	probably damaging	Het
Efcab8	T	C	2: 153,783,768	L116P	probably damaging	Het
Efnb2	T	C	8: 8,660,524	I31V	probably benign	Het
Fbxl12	A	T	9: 20,638,615	L271Q	probably damaging	Het
Fmn1	T	A	2: 113,596,338	N1133K	probably damaging	Het
Frmpd2	T	C	14: 33,565,907	S1219P	probably benign	Het
Gm7298	A	T	6: 121,782,704	R1187S	probably damaging	Het
H6pd	T	C	4: 149,995,957	I136V	probably benign	Het
Hyal2	A	G	9: 107,570,715	N189S	probably benign	Het
Jmjd1c	C	T	10: 67,249,660	P2410S	probably damaging	Het
Larp1	A	G	11: 58,042,263	D231G	probably damaging	Het
Lilra5	T	A	7: 4,241,928	S233T	possibly damaging	Het
Lrrc43	T	C	5: 123,503,277	F508S	probably damaging	Het
Marc2	T	C	1: 184,833,943	R85G	probably damaging	Het
March4	T	C	1: 72,452,488	Y208C	probably damaging	Het
Nr1h2	A	T	7: 44,552,052	C45*	probably null	Het
Olfr1123	T	A	2: 87,419,006	S319R	probably benign	Het
Olfr138	A	G	17: 38,275,148	I126V	probably benign	Het
Ppp2r5d	G	T	17: 46,685,703		probably null	Het
Prpf40a	A	T	2: 53,156,627	S324T	probably benign	Het
Psmb7	T	C	2: 38,640,187	D94G	probably damaging	Het
Psmd11	A	G	11: 80,445,941	T140A	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rbp3	G	A	14: 33,954,461	R122H	probably benign	Het
Rrp8	T	C	7: 105,736,389	E3G	probably damaging	Het
Sacm1l	T	C	9: 123,542,420	S37P	probably damaging	Het
Slc12a3	A	G	8: 94,358,471	R939G	possibly damaging	Het
Slc20a1	T	C	2: 129,209,894	S608P	possibly damaging	Het
Sntg1	T	C	1: 8,554,729	Q281R	possibly damaging	Het
Tefm	A	G	11: 80,137,988	L194P	probably damaging	Het
Terf2ip	T	A	8: 112,011,915	V145E	probably damaging	Het
Tmem231	T	A	8: 111,915,265	E219V	probably null	Het
Tmx3	T	A	18: 90,537,210		probably null	Het
Tns3	G	A	11: 8,492,987	P459S	probably damaging	Het
Trav13d-1	T	A	14: 52,851,763	S76R	probably benign	Het
Trp63	A	G	16: 25,862,460	N254S	probably damaging	Het
Tsen34	A	G	7: 3,693,985		probably benign	Het
Unc13d	A	G	11: 116,068,238	V701A	probably damaging	Het
Uspl1	T	A	5: 149,204,366	S392T	probably damaging	Het
Vmn2r102	T	A	17: 19,678,745	C450S	probably benign	Het
Zfp128	T	C	7: 12,890,970	Y422H	possibly damaging	Het
Zkscan7	C	T	9: 122,895,234	Q423*	probably null	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118275014	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118276831	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118284999	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118276157	missense	possibly damaging	0.95
R9325:Usp36	UTSW	11	118269205	missense	possibly damaging	0.69
R9529:Usp36	UTSW	11	118268635	nonsense	probably null
R9774:Usp36	UTSW	11	118263049	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTCTCAGCTTGCAAACCG -3'
(R):5'- CCATTACTAACGGGCACAGG -3'

Sequencing Primer
(F):5'- CTGAAGTCCTCTGTGATTCC -3'
(R):5'- GGATTCAAGCAGCTCCAGC -3'

Posted On

2018-03-15