Incidental Mutation 'R6266:Rbp3'
ID507029
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33954461 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably benign
Transcript: ENSMUST00000035695
AA Change: R122H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: R122H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACGAGATTCTGGGCATCTC -3'
(R):5'- GTTCCCAGGGTGCAAGTAAG -3'

Sequencing Primer
(F):5'- AGATTCTGGGCATCTCAGACC -3'
(R):5'- TTCCCAGGGTGCAAGTAAGAGATG -3'
Posted On2018-03-15