Incidental Mutation 'R6266:Ccser2'
ID507030
Institutional Source Beutler Lab
Gene Symbol Ccser2
Ensembl Gene ENSMUSG00000058690
Gene Namecoiled-coil serine rich 2
Synonyms1700012P13Rik, 2900054P12Rik, Gcap14
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location36874936-36968777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36879675 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 276 (P276L)
Ref Sequence ENSEMBL: ENSMUSP00000138787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067700] [ENSMUST00000090024] [ENSMUST00000182042] [ENSMUST00000182576] [ENSMUST00000182797] [ENSMUST00000183007] [ENSMUST00000183038] [ENSMUST00000183316]
Predicted Effect probably benign
Transcript: ENSMUST00000067700
AA Change: H804Y

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068550
Gene: ENSMUSG00000058690
AA Change: H804Y

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090024
AA Change: P832L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087478
Gene: ENSMUSG00000058690
AA Change: P832L

DomainStartEndE-ValueType
low complexity region 389 412 N/A INTRINSIC
low complexity region 496 506 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 603 616 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 710 747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182042
AA Change: P260L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138453
Gene: ENSMUSG00000058690
AA Change: P260L

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182558
Predicted Effect probably benign
Transcript: ENSMUST00000182576
SMART Domains Protein: ENSMUSP00000138318
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182797
AA Change: P276L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138787
Gene: ENSMUSG00000058690
AA Change: P276L

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183007
AA Change: H141Y

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000183038
AA Change: H251Y

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138718
Gene: ENSMUSG00000058690
AA Change: H251Y

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183316
SMART Domains Protein: ENSMUSP00000138100
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
coiled coil region 78 115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Ccser2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ccser2 APN 14 36940064 missense probably damaging 1.00
IGL01285:Ccser2 APN 14 36938669 missense probably damaging 1.00
IGL01622:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL01623:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL02322:Ccser2 APN 14 36909129 missense probably damaging 1.00
IGL02342:Ccser2 APN 14 36918605 splice site probably benign
IGL02899:Ccser2 APN 14 36940759 missense probably benign 0.39
R0433:Ccser2 UTSW 14 36918529 missense probably damaging 1.00
R0543:Ccser2 UTSW 14 36940192 missense probably benign
R0674:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R0853:Ccser2 UTSW 14 36940410 missense probably benign 0.18
R0964:Ccser2 UTSW 14 36909008 splice site probably benign
R1748:Ccser2 UTSW 14 36896313 missense probably damaging 1.00
R1748:Ccser2 UTSW 14 36896314 nonsense probably null
R1854:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R2405:Ccser2 UTSW 14 36938669 missense probably damaging 1.00
R2926:Ccser2 UTSW 14 36879561 missense possibly damaging 0.91
R3846:Ccser2 UTSW 14 36940288 missense probably benign
R4298:Ccser2 UTSW 14 36890380 missense possibly damaging 0.63
R4701:Ccser2 UTSW 14 36938697 missense probably damaging 1.00
R4746:Ccser2 UTSW 14 36909125 missense probably damaging 1.00
R4888:Ccser2 UTSW 14 36940386 missense probably damaging 0.98
R4959:Ccser2 UTSW 14 36940796 missense probably benign 0.00
R5020:Ccser2 UTSW 14 36940177 missense probably benign 0.00
R5179:Ccser2 UTSW 14 36879351 missense possibly damaging 0.79
R5378:Ccser2 UTSW 14 36879434 missense possibly damaging 0.65
R6011:Ccser2 UTSW 14 36879575 missense probably benign 0.17
R6057:Ccser2 UTSW 14 36941165 missense probably damaging 0.98
R6180:Ccser2 UTSW 14 36940319 missense probably benign
R6216:Ccser2 UTSW 14 36940508 missense probably damaging 1.00
R6244:Ccser2 UTSW 14 36940718 missense probably benign 0.00
R6730:Ccser2 UTSW 14 36879086 missense probably damaging 1.00
R6862:Ccser2 UTSW 14 36940081 missense probably benign
R7025:Ccser2 UTSW 14 36940007 missense probably damaging 1.00
R7076:Ccser2 UTSW 14 36939829 missense probably benign 0.14
R7092:Ccser2 UTSW 14 36940655 missense probably benign 0.03
R7353:Ccser2 UTSW 14 36941143 missense possibly damaging 0.91
R7440:Ccser2 UTSW 14 36898217 missense possibly damaging 0.92
R7509:Ccser2 UTSW 14 36938645 missense probably damaging 1.00
R7555:Ccser2 UTSW 14 36879500 missense possibly damaging 0.65
R7770:Ccser2 UTSW 14 36926874 missense probably damaging 1.00
X0066:Ccser2 UTSW 14 36940999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCAGGTCCGTTTCAGAAG -3'
(R):5'- TGATCCCGTGGAGATAAGGC -3'

Sequencing Primer
(F):5'- CGTTTCAGAAGGTATGTACTTCACC -3'
(R):5'- TCCCGTGGAGATAAGGCTGAAG -3'
Posted On2018-03-15