Incidental Mutation 'R6267:Nmnat2'
ID 507046
Institutional Source Beutler Lab
Gene Symbol Nmnat2
Ensembl Gene ENSMUSG00000042751
Gene Name nicotinamide nucleotide adenylyltransferase 2
Synonyms PNAT1, D030041I09Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6267 (G1)
Quality Score 202.009
Status Not validated
Chromosome 1
Chromosomal Location 152954993-153119261 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 153076971 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 102 (H102L)
Ref Sequence ENSEMBL: ENSMUSP00000140585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043313] [ENSMUST00000186368] [ENSMUST00000186621]
AlphaFold Q8BNJ3
Predicted Effect probably damaging
Transcript: ENSMUST00000043313
AA Change: H102L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751
AA Change: H102L

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185241
Predicted Effect probably damaging
Transcript: ENSMUST00000186368
AA Change: H102L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140585
Gene: ENSMUSG00000042751
AA Change: H102L

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 275 2e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186621
AA Change: H78L

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140497
Gene: ENSMUSG00000042751
AA Change: H78L

DomainStartEndE-ValueType
Pfam:CTP_transf_2 1 184 9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190117
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family, members of which catalyze an essential step in NAD (NADP) biosynthetic pathway. Unlike the other human family member, which is localized to the nucleus, and is ubiquitously expressed; this enzyme is cytoplasmic, and is predominantly expressed in the brain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap or transposon inserted allele exhibit perinatal lethality, distended bladders, atelectasis and loss of axon integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Nmnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Nmnat2 APN 1 153094117 splice site probably null
IGL01447:Nmnat2 APN 1 153112443 missense possibly damaging 0.50
IGL01686:Nmnat2 APN 1 153076997 splice site probably benign
IGL01916:Nmnat2 APN 1 153094046 missense probably damaging 0.99
R0309:Nmnat2 UTSW 1 153077001 splice site probably benign
R1245:Nmnat2 UTSW 1 153112203 missense probably benign 0.12
R1475:Nmnat2 UTSW 1 153074695 missense probably damaging 1.00
R1780:Nmnat2 UTSW 1 153112440 nonsense probably null
R2860:Nmnat2 UTSW 1 153112425 missense probably benign
R2861:Nmnat2 UTSW 1 153112425 missense probably benign
R2862:Nmnat2 UTSW 1 153112425 missense probably benign
R2939:Nmnat2 UTSW 1 153074728 missense probably damaging 1.00
R5590:Nmnat2 UTSW 1 153094061 missense probably damaging 1.00
R6056:Nmnat2 UTSW 1 153074734 nonsense probably null
R9287:Nmnat2 UTSW 1 153086392 missense probably damaging 0.98
R9334:Nmnat2 UTSW 1 153073839 missense probably damaging 1.00
R9481:Nmnat2 UTSW 1 153086435 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTCCACAGCCTGGTGTAAC -3'
(R):5'- TATGGAGAAAGGCTGGTGCTC -3'

Sequencing Primer
(F):5'- TGTAACCTGCTTTGAGCTCTAAG -3'
(R):5'- GGTGCTCCAGAGTCCTAATTCACTG -3'
Posted On 2018-03-15