Mutagenetix > Incidental Mutation

Incidental Mutation 'R6267:Garnl3'

507048

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R6267 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33104880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 39 (D39G)

Ref Sequence

ENSEMBL: ENSMUSP00000141523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]

AlphaFold

Q3V0G7

Predicted Effect

probably benign
Transcript: ENSMUST00000124000
AA Change: D79G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860
AA Change: D79G

Domain	Start	End	E-Value	Type
low complexity region	6	24	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127509
AA Change: D39G

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000133135
AA Change: D39G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000137381
AA Change: D39G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139778

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Abi3bp	A	G	16: 56,594,497	T341A	probably damaging	Het
Acer2	T	C	4: 86,874,586	F33S	probably damaging	Het
Actr1b	A	G	1: 36,701,163	V299A	possibly damaging	Het
Ampd3	T	A	7: 110,791,180		probably null	Het
Atm	A	C	9: 53,444,000	I2898R	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Chd2	T	C	7: 73,463,671	E1187G	probably damaging	Het
Cntrl	T	C	2: 35,129,793	L544P	probably damaging	Het
Cryga	A	C	1: 65,103,010	S75A	probably benign	Het
Dcbld1	T	A	10: 52,319,480	Y261*	probably null	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dst	A	C	1: 34,228,672	D5065A	probably damaging	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Eif4enif1	T	A	11: 3,227,793	V395E	probably damaging	Het
Enox1	A	G	14: 77,577,764	T121A	probably damaging	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Fcrl5	G	A	3: 87,448,324	G448E	probably damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Gm14295	C	T	2: 176,808,989	Q91*	probably null	Het
Grb10	T	A	11: 11,970,639		probably benign	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Herc2	T	A	7: 56,153,166	C2112*	probably null	Het
Herc2	T	G	7: 56,204,718	L3797R	possibly damaging	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kif13b	A	G	14: 64,738,634	Y466C	probably damaging	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lingo4	G	A	3: 94,403,390	G545E	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lor	C	A	3: 92,081,812	G56*	probably null	Het
Lrfn1	A	G	7: 28,459,744	R363G	probably benign	Het
Lrp1b	T	C	2: 40,657,525	D446G	probably benign	Het
Ltbp1	G	T	17: 75,005,989	G35V	possibly damaging	Het
Magel2	G	A	7: 62,378,679	V444M	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Ms4a7	A	T	19: 11,333,295	I20N	possibly damaging	Het
Myo5b	A	G	18: 74,616,991	Y173C	probably damaging	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nmnat2	A	T	1: 153,076,971	H102L	probably damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr686	G	A	7: 105,203,392	T317I	probably damaging	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Pitpnm1	T	C	19: 4,110,522	L781P	probably damaging	Het
Prdm14	A	T	1: 13,118,936	C395S	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rorb	C	A	19: 18,977,857	V47L	possibly damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Sdr16c5	C	T	4: 4,016,162	G88E	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Slc52a3	G	T	2: 152,007,609		probably null	Het
Smco1	A	T	16: 32,274,014	M168L	probably benign	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Tmem225	T	A	9: 40,148,435	I37N	probably damaging	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Usp16	A	G	16: 87,483,191	N813S	probably benign	Het
Vmn1r128	A	T	7: 21,350,296	*308C	probably null	Het
Vmn2r45	A	G	7: 8,472,208	V607A	probably benign	Het
Vmn2r63	A	T	7: 42,928,635		probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8087:Garnl3	UTSW	2	33045536	missense	probably benign	0.01
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
R8679:Garnl3	UTSW	2	33026094	missense	probably damaging	1.00
R8940:Garnl3	UTSW	2	33005229	critical splice acceptor site	probably null
R9081:Garnl3	UTSW	2	33006908	missense	possibly damaging	0.90
R9183:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9213:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9219:Garnl3	UTSW	2	33085886	missense	probably damaging	1.00
R9453:Garnl3	UTSW	2	33003869	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTTGGTTAAAGGAGATGCCCAG -3'
(R):5'- AAGGCTGTCGTCCTTAAGCTG -3'

Sequencing Primer
(F):5'- GATGCCCAGTGAAAACTGCCG -3'
(R):5'- GGCTGCCCTTATTGCTGAGTC -3'

Posted On

2018-03-15