Incidental Mutation 'R6267:Loricrin'
ID 507058
Institutional Source Beutler Lab
Gene Symbol Loricrin
Ensembl Gene ENSMUSG00000043165
Gene Name loricrin cornified envelope precursor protein
Synonyms
MMRRC Submission 044405-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6267 (G1)
Quality Score 94.0077
Status Not validated
Chromosome 3
Chromosomal Location 91987578-91990447 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 91989119 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 56 (G56*)
Ref Sequence ENSEMBL: ENSMUSP00000052128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058150]
AlphaFold P18165
Predicted Effect probably null
Transcript: ENSMUST00000058150
AA Change: G56*
SMART Domains Protein: ENSMUSP00000052128
Gene: ENSMUSG00000043165
AA Change: G56*

DomainStartEndE-ValueType
Pfam:Loricrin 316 438 2.7e-11 PFAM
Pfam:Loricrin 426 486 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene are runted at birth, have a translucent skin and skin skin barrier defect. The morphological skin phenotype disappears after 4-5 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,086,580 (GRCm39) K277R probably damaging Het
Aatf T C 11: 84,363,926 (GRCm39) Y267C probably benign Het
Abi3bp A G 16: 56,414,860 (GRCm39) T341A probably damaging Het
Acer2 T C 4: 86,792,823 (GRCm39) F33S probably damaging Het
Actr1b A G 1: 36,740,244 (GRCm39) V299A possibly damaging Het
Ampd3 T A 7: 110,390,387 (GRCm39) probably null Het
Atm A C 9: 53,355,300 (GRCm39) I2898R probably damaging Het
Bpifb6 G C 2: 153,748,812 (GRCm39) K269N possibly damaging Het
Cacna1c T C 6: 118,575,684 (GRCm39) E1927G possibly damaging Het
Cacna1c T A 6: 118,629,675 (GRCm39) T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,579,599 (GRCm39) probably null Het
Cbll1 A G 12: 31,537,507 (GRCm39) V415A probably benign Het
Cd300lf C T 11: 115,015,195 (GRCm39) V132I probably benign Het
Chd2 T C 7: 73,113,419 (GRCm39) E1187G probably damaging Het
Cntrl T C 2: 35,019,805 (GRCm39) L544P probably damaging Het
Cryga A C 1: 65,142,169 (GRCm39) S75A probably benign Het
Dcbld1 T A 10: 52,195,576 (GRCm39) Y261* probably null Het
Ddx11 G A 17: 66,457,724 (GRCm39) probably null Het
Dgke C T 11: 88,931,575 (GRCm39) V560I probably benign Het
Dst A C 1: 34,267,753 (GRCm39) D5065A probably damaging Het
Dusp16 C A 6: 134,697,456 (GRCm39) probably null Het
Eif4enif1 T A 11: 3,177,793 (GRCm39) V395E probably damaging Het
Enox1 A G 14: 77,815,204 (GRCm39) T121A probably damaging Het
Enpp4 G T 17: 44,413,371 (GRCm39) N54K probably benign Het
Erc2 A T 14: 27,802,112 (GRCm39) K764M probably damaging Het
Ercc6 G T 14: 32,248,360 (GRCm39) E304* probably null Het
Fam117a T A 11: 95,254,971 (GRCm39) C115S possibly damaging Het
Fcrl5 G A 3: 87,355,631 (GRCm39) G448E probably damaging Het
Galntl5 T C 5: 25,391,163 (GRCm39) S21P probably benign Het
Garnl3 T C 2: 32,994,892 (GRCm39) D39G probably benign Het
Gm14295 C T 2: 176,500,782 (GRCm39) Q91* probably null Het
Grb10 T A 11: 11,920,639 (GRCm39) probably benign Het
Grip1 C T 10: 119,911,369 (GRCm39) Q696* probably null Het
Herc2 T A 7: 55,802,914 (GRCm39) C2112* probably null Het
Herc2 T G 7: 55,854,466 (GRCm39) L3797R possibly damaging Het
Ighm T C 12: 113,385,187 (GRCm39) I258V unknown Het
Jarid2 T A 13: 45,056,539 (GRCm39) Y443N possibly damaging Het
Kif13b A G 14: 64,976,083 (GRCm39) Y466C probably damaging Het
Krtap4-6 T A 11: 99,556,245 (GRCm39) R161* probably null Het
Lingo4 G A 3: 94,310,697 (GRCm39) G545E probably benign Het
Lmo2 T G 2: 103,800,946 (GRCm39) V39G possibly damaging Het
Lrfn1 A G 7: 28,159,169 (GRCm39) R363G probably benign Het
Lrp1b T C 2: 40,547,537 (GRCm39) D446G probably benign Het
Ltbp1 G T 17: 75,312,984 (GRCm39) G35V possibly damaging Het
Magel2 G A 7: 62,028,427 (GRCm39) V444M probably damaging Het
Mkx A T 18: 7,000,591 (GRCm39) probably null Het
Ms4a7 A T 19: 11,310,659 (GRCm39) I20N possibly damaging Het
Myo5b A G 18: 74,750,062 (GRCm39) Y173C probably damaging Het
Nek1 C T 8: 61,525,343 (GRCm39) Q594* probably null Het
Nipbl T C 15: 8,330,379 (GRCm39) M2349V possibly damaging Het
Nmnat2 A T 1: 152,952,717 (GRCm39) H102L probably damaging Het
Nup155 T A 15: 8,182,639 (GRCm39) C1201S probably damaging Het
Or2y8 C A 11: 52,035,423 (GRCm39) R311S probably benign Het
Or4a76 G A 2: 89,460,975 (GRCm39) T89I probably damaging Het
Or52x1 G A 7: 104,852,599 (GRCm39) T317I probably damaging Het
Osbpl1a A G 18: 12,952,560 (GRCm39) probably null Het
Pcnt A G 10: 76,221,632 (GRCm39) V1998A probably benign Het
Pitpnc1 T C 11: 107,117,092 (GRCm39) H193R probably damaging Het
Pitpnm1 T C 19: 4,160,522 (GRCm39) L781P probably damaging Het
Prdm14 A T 1: 13,189,160 (GRCm39) C395S probably damaging Het
Prmt8 A G 6: 127,688,767 (GRCm39) I201T probably damaging Het
Pter T C 2: 12,983,352 (GRCm39) V119A probably damaging Het
Rab11fip4 T C 11: 79,581,655 (GRCm39) probably null Het
Rgs9 T C 11: 109,159,813 (GRCm39) N173S probably benign Het
Rorb C A 19: 18,955,221 (GRCm39) V47L possibly damaging Het
Rtn4r A G 16: 17,969,046 (GRCm39) Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 (GRCm39) G88E probably damaging Het
Sfxn1 C T 13: 54,247,899 (GRCm39) T208I probably benign Het
Sgo2b C T 8: 64,380,827 (GRCm39) M668I probably benign Het
Slc52a3 G T 2: 151,849,529 (GRCm39) probably null Het
Smco1 A T 16: 32,092,832 (GRCm39) M168L probably benign Het
Spata31d1d G A 13: 59,876,278 (GRCm39) T419I possibly damaging Het
Spata31d1e T C 13: 59,890,497 (GRCm39) D441G probably benign Het
Spink5 T C 18: 44,147,824 (GRCm39) S857P probably damaging Het
Stk35 T A 2: 129,652,808 (GRCm39) Y436* probably null Het
Tmem225 T A 9: 40,059,731 (GRCm39) I37N probably damaging Het
Unkl T C 17: 25,450,839 (GRCm39) *232R probably null Het
Usp16 A G 16: 87,280,079 (GRCm39) N813S probably benign Het
Vmn1r128 A T 7: 21,084,221 (GRCm39) *308C probably null Het
Vmn2r45 A G 7: 8,475,207 (GRCm39) V607A probably benign Het
Vmn2r63 A T 7: 42,578,059 (GRCm39) probably null Het
Wnk4 A T 11: 101,164,824 (GRCm39) N718Y probably damaging Het
Zfp503 G C 14: 22,035,868 (GRCm39) Y349* probably null Het
Zfp990 T A 4: 145,264,673 (GRCm39) F557Y possibly damaging Het
Other mutations in Loricrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Loricrin UTSW 3 91,989,201 (GRCm39) frame shift probably null
R2932:Loricrin UTSW 3 91,989,185 (GRCm39) small deletion probably benign
R4677:Loricrin UTSW 3 91,989,050 (GRCm39) missense unknown
R5454:Loricrin UTSW 3 91,988,789 (GRCm39) missense unknown
R5851:Loricrin UTSW 3 91,987,846 (GRCm39) missense unknown
R7219:Loricrin UTSW 3 91,988,705 (GRCm39) missense unknown
R7430:Loricrin UTSW 3 91,989,206 (GRCm39) missense unknown
R7780:Loricrin UTSW 3 91,988,460 (GRCm39) nonsense probably null
R8983:Loricrin UTSW 3 91,988,446 (GRCm39) missense unknown
RF027:Loricrin UTSW 3 91,989,183 (GRCm39) small deletion probably benign
RF028:Loricrin UTSW 3 91,989,206 (GRCm39) frame shift probably null
RF031:Loricrin UTSW 3 91,989,183 (GRCm39) small deletion probably benign
X0057:Loricrin UTSW 3 91,989,185 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCCGGAGTACTTGACGC -3'
(R):5'- TTCTCCTTAAACAAGATGTCTCACC -3'

Sequencing Primer
(F):5'- GAGTACTTGACGCCCCCAC -3'
(R):5'- GATGTCTCACCAGAAAAAGCAG -3'
Posted On 2018-03-15