Mutagenetix > Incidental Mutation

Incidental Mutation 'R6267:Chd2'

507075

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

2810040A01Rik, 2810013C04Rik, 5630401D06Rik

MMRRC Submission

044405-MU

Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Essential gene?

Possibly essential (E-score: 0.572) question?

Stock #

R6267 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73426638-73541830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73463671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1187 (E1187G)

Ref Sequence

ENSEMBL: ENSMUSP00000126352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169922]

AlphaFold

E9PZM4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000038366

Predicted Effect

probably damaging
Transcript: ENSMUST00000169922
AA Change: E1187G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E1187G

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000199809
AA Change: E93G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206316

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Abi3bp	A	G	16: 56,594,497	T341A	probably damaging	Het
Acer2	T	C	4: 86,874,586	F33S	probably damaging	Het
Actr1b	A	G	1: 36,701,163	V299A	possibly damaging	Het
Ampd3	T	A	7: 110,791,180		probably null	Het
Atm	A	C	9: 53,444,000	I2898R	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Cntrl	T	C	2: 35,129,793	L544P	probably damaging	Het
Cryga	A	C	1: 65,103,010	S75A	probably benign	Het
Dcbld1	T	A	10: 52,319,480	Y261*	probably null	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dst	A	C	1: 34,228,672	D5065A	probably damaging	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Eif4enif1	T	A	11: 3,227,793	V395E	probably damaging	Het
Enox1	A	G	14: 77,577,764	T121A	probably damaging	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Fcrl5	G	A	3: 87,448,324	G448E	probably damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Garnl3	T	C	2: 33,104,880	D39G	probably benign	Het
Gm14295	C	T	2: 176,808,989	Q91*	probably null	Het
Grb10	T	A	11: 11,970,639		probably benign	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Herc2	T	A	7: 56,153,166	C2112*	probably null	Het
Herc2	T	G	7: 56,204,718	L3797R	possibly damaging	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kif13b	A	G	14: 64,738,634	Y466C	probably damaging	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lingo4	G	A	3: 94,403,390	G545E	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lor	C	A	3: 92,081,812	G56*	probably null	Het
Lrfn1	A	G	7: 28,459,744	R363G	probably benign	Het
Lrp1b	T	C	2: 40,657,525	D446G	probably benign	Het
Ltbp1	G	T	17: 75,005,989	G35V	possibly damaging	Het
Magel2	G	A	7: 62,378,679	V444M	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Ms4a7	A	T	19: 11,333,295	I20N	possibly damaging	Het
Myo5b	A	G	18: 74,616,991	Y173C	probably damaging	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nmnat2	A	T	1: 153,076,971	H102L	probably damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr686	G	A	7: 105,203,392	T317I	probably damaging	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Pitpnm1	T	C	19: 4,110,522	L781P	probably damaging	Het
Prdm14	A	T	1: 13,118,936	C395S	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rorb	C	A	19: 18,977,857	V47L	possibly damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Sdr16c5	C	T	4: 4,016,162	G88E	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Slc52a3	G	T	2: 152,007,609		probably null	Het
Smco1	A	T	16: 32,274,014	M168L	probably benign	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Tmem225	T	A	9: 40,148,435	I37N	probably damaging	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Usp16	A	G	16: 87,483,191	N813S	probably benign	Het
Vmn1r128	A	T	7: 21,350,296	*308C	probably null	Het
Vmn2r45	A	G	7: 8,472,208	V607A	probably benign	Het
Vmn2r63	A	T	7: 42,928,635		probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73468577	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73540828	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73444249	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73441686	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73441627	splice site	probably null
IGL02083:Chd2	APN	7	73481068	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73441717	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73497708	splice site	probably null
IGL02385:Chd2	APN	7	73435822	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73447320	unclassified	probably benign
IGL02590:Chd2	APN	7	73453200	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73475349	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73493456	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73453166	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73502104	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73480968	missense	probably benign
F6893:Chd2	UTSW	7	73507872	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73484534	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73447274	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73484517	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73453136	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73490614	nonsense	probably null
R1599:Chd2	UTSW	7	73473051	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73480430	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73454445	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73429987	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73478668	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73503420	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73507883	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73468490	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73471790	unclassified	probably benign
R3788:Chd2	UTSW	7	73447130	unclassified	probably benign
R3826:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73464395	splice site	probably benign
R4093:Chd2	UTSW	7	73501016	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73435961	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73540874	intron	probably benign
R4782:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73502125	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73480508	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73429689	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73463681	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73473085	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73484484	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73491357	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73484602	splice site	probably null
R5834:Chd2	UTSW	7	73478715	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73537312	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73435842	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73444323	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73451723	missense	possibly damaging	0.76
R6310:Chd2	UTSW	7	73453164	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73480406	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73501037	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73503443	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73493565	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73490482	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73475379	nonsense	probably null
R6860:Chd2	UTSW	7	73497810	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73475423	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73484411	nonsense	probably null
R7095:Chd2	UTSW	7	73471881	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73469670	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73475420	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73451808	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73441642	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73435773	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73471819	missense	probably null	1.00
R7898:Chd2	UTSW	7	73519475	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73499625	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73435880	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73451758	missense	probably benign
R8071:Chd2	UTSW	7	73537384	missense	probably benign
R8188:Chd2	UTSW	7	73429756	nonsense	probably null
R8196:Chd2	UTSW	7	73468537	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73429735	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73490497	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73502035	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73503462	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73484546	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73490654	missense	probably benign	0.12
R9009:Chd2	UTSW	7	73493444	missense	probably benign	0.39
R9021:Chd2	UTSW	7	73441645	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73455610	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73493531	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73449170	missense	probably null	1.00
R9501:Chd2	UTSW	7	73441733	missense	possibly damaging	0.92
R9501:Chd2	UTSW	7	73480546	missense	probably damaging	1.00
R9550:Chd2	UTSW	7	73469691	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73480482	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73429807	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73519662	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73507837	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73468586	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- TAGATGGGGTCTCAACACAGC -3'
(R):5'- CAGGTATCTTTCAAGAGCAAGCAC -3'

Sequencing Primer
(F):5'- GGGTCTCAACACAGCTCACAG -3'
(R):5'- CTTTCAAGAGCAAGCACTTGTGAG -3'

Posted On

2018-03-15