Incidental Mutation 'R6267:Cars2'
ID507078
Institutional Source Beutler Lab
Gene Symbol Cars2
Ensembl Gene ENSMUSG00000056228
Gene Namecysteinyl-tRNA synthetase 2 (mitochondrial)(putative)
SynonymsD530030H10Rik, 2310051N18Rik, 2410044A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6267 (G1)
Quality Score159.468
Status Not validated
Chromosome8
Chromosomal Location11513977-11550783 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCCC to TCCC at 11529599 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049461] [ENSMUST00000210478] [ENSMUST00000210599]
Predicted Effect probably null
Transcript: ENSMUST00000049461
SMART Domains Protein: ENSMUSP00000046453
Gene: ENSMUSG00000056228

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:tRNA-synt_1e 50 351 4.1e-116 PFAM
Pfam:tRNA-synt_1g 63 207 1.5e-7 PFAM
Pfam:tRNA-synt_1g 280 370 4.2e-7 PFAM
Blast:DALR_2 391 461 3e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209236
Predicted Effect probably benign
Transcript: ENSMUST00000210478
Predicted Effect probably benign
Transcript: ENSMUST00000210599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211406
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Cars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
madcow UTSW 8 11526034 missense probably damaging 1.00
PIT4810001:Cars2 UTSW 8 11514699 missense probably benign
R0633:Cars2 UTSW 8 11550511 missense probably benign 0.00
R0788:Cars2 UTSW 8 11529672 missense possibly damaging 0.76
R1493:Cars2 UTSW 8 11517817 critical splice donor site probably null
R1559:Cars2 UTSW 8 11530430 splice site probably null
R1846:Cars2 UTSW 8 11514674 missense probably benign 0.03
R1954:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1955:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1993:Cars2 UTSW 8 11514515 missense probably benign 0.03
R2062:Cars2 UTSW 8 11547747 missense probably damaging 1.00
R2153:Cars2 UTSW 8 11530299 missense possibly damaging 0.87
R5004:Cars2 UTSW 8 11518956 splice site probably null
R5320:Cars2 UTSW 8 11517854 missense probably benign 0.09
R6004:Cars2 UTSW 8 11547743 missense probably damaging 1.00
R6089:Cars2 UTSW 8 11530301 missense probably damaging 0.98
R6265:Cars2 UTSW 8 11529599 frame shift probably null
R6268:Cars2 UTSW 8 11529599 frame shift probably null
R6841:Cars2 UTSW 8 11516198 missense probably benign 0.01
R7076:Cars2 UTSW 8 11529649 missense probably damaging 1.00
R7586:Cars2 UTSW 8 11530321 nonsense probably null
R8342:Cars2 UTSW 8 11529706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTTACAGGCTGGAGTG -3'
(R):5'- CACATATTTTATAGCCTGAGGAGGG -3'

Sequencing Primer
(F):5'- TGGTATGGTCAGTATGGTAAGATAC -3'
(R):5'- CCTGAGGAGGGCTGCGG -3'
Posted On2018-03-15