Mutagenetix > Incidental Mutation

Incidental Mutation 'R6267:Cars2'

507078

Institutional Source

Beutler Lab

Gene Symbol

Cars2

Ensembl Gene

ENSMUSG00000056228

Gene Name

cysteinyl-tRNA synthetase 2 (mitochondrial)(putative)

Synonyms

D530030H10Rik, 2310051N18Rik, 2410044A07Rik

MMRRC Submission

044405-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6267 (G1)

Quality Score

159.468

Status

Not validated

Chromosome

Chromosomal Location

11513977-11550783 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TCCCC to TCCC at 11529599 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049461] [ENSMUST00000210478] [ENSMUST00000210599]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000049461

SMART Domains

Protein: ENSMUSP00000046453
Gene: ENSMUSG00000056228

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:tRNA-synt_1e	50	351	4.1e-116	PFAM
Pfam:tRNA-synt_1g	63	207	1.5e-7	PFAM
Pfam:tRNA-synt_1g	280	370	4.2e-7	PFAM
Blast:DALR_2	391	461	3e-37	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209218

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209236

Predicted Effect

probably benign
Transcript: ENSMUST00000210478

Predicted Effect

probably benign
Transcript: ENSMUST00000210599

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211406

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Abi3bp	A	G	16: 56,594,497	T341A	probably damaging	Het
Acer2	T	C	4: 86,874,586	F33S	probably damaging	Het
Actr1b	A	G	1: 36,701,163	V299A	possibly damaging	Het
Ampd3	T	A	7: 110,791,180		probably null	Het
Atm	A	C	9: 53,444,000	I2898R	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Chd2	T	C	7: 73,463,671	E1187G	probably damaging	Het
Cntrl	T	C	2: 35,129,793	L544P	probably damaging	Het
Cryga	A	C	1: 65,103,010	S75A	probably benign	Het
Dcbld1	T	A	10: 52,319,480	Y261*	probably null	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dst	A	C	1: 34,228,672	D5065A	probably damaging	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Eif4enif1	T	A	11: 3,227,793	V395E	probably damaging	Het
Enox1	A	G	14: 77,577,764	T121A	probably damaging	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Fcrl5	G	A	3: 87,448,324	G448E	probably damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Garnl3	T	C	2: 33,104,880	D39G	probably benign	Het
Gm14295	C	T	2: 176,808,989	Q91*	probably null	Het
Grb10	T	A	11: 11,970,639		probably benign	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Herc2	T	A	7: 56,153,166	C2112*	probably null	Het
Herc2	T	G	7: 56,204,718	L3797R	possibly damaging	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kif13b	A	G	14: 64,738,634	Y466C	probably damaging	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lingo4	G	A	3: 94,403,390	G545E	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lor	C	A	3: 92,081,812	G56*	probably null	Het
Lrfn1	A	G	7: 28,459,744	R363G	probably benign	Het
Lrp1b	T	C	2: 40,657,525	D446G	probably benign	Het
Ltbp1	G	T	17: 75,005,989	G35V	possibly damaging	Het
Magel2	G	A	7: 62,378,679	V444M	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Ms4a7	A	T	19: 11,333,295	I20N	possibly damaging	Het
Myo5b	A	G	18: 74,616,991	Y173C	probably damaging	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nmnat2	A	T	1: 153,076,971	H102L	probably damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr686	G	A	7: 105,203,392	T317I	probably damaging	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Pitpnm1	T	C	19: 4,110,522	L781P	probably damaging	Het
Prdm14	A	T	1: 13,118,936	C395S	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rorb	C	A	19: 18,977,857	V47L	possibly damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Sdr16c5	C	T	4: 4,016,162	G88E	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Slc52a3	G	T	2: 152,007,609		probably null	Het
Smco1	A	T	16: 32,274,014	M168L	probably benign	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Tmem225	T	A	9: 40,148,435	I37N	probably damaging	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Usp16	A	G	16: 87,483,191	N813S	probably benign	Het
Vmn1r128	A	T	7: 21,350,296	*308C	probably null	Het
Vmn2r45	A	G	7: 8,472,208	V607A	probably benign	Het
Vmn2r63	A	T	7: 42,928,635		probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Cars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
madcow	UTSW	8	11526034	missense	probably damaging	1.00
PIT4810001:Cars2	UTSW	8	11514699	missense	probably benign
R0633:Cars2	UTSW	8	11550511	missense	probably benign	0.00
R0788:Cars2	UTSW	8	11529672	missense	possibly damaging	0.76
R1493:Cars2	UTSW	8	11517817	critical splice donor site	probably null
R1559:Cars2	UTSW	8	11530430	splice site	probably null
R1846:Cars2	UTSW	8	11514674	missense	probably benign	0.03
R1954:Cars2	UTSW	8	11550286	missense	probably damaging	1.00
R1955:Cars2	UTSW	8	11550286	missense	probably damaging	1.00
R1993:Cars2	UTSW	8	11514515	missense	probably benign	0.03
R2062:Cars2	UTSW	8	11547747	missense	probably damaging	1.00
R2153:Cars2	UTSW	8	11530299	missense	possibly damaging	0.87
R5004:Cars2	UTSW	8	11518956	splice site	probably null
R5320:Cars2	UTSW	8	11517854	missense	probably benign	0.09
R6004:Cars2	UTSW	8	11547743	missense	probably damaging	1.00
R6089:Cars2	UTSW	8	11530301	missense	probably damaging	0.98
R6265:Cars2	UTSW	8	11529599	frame shift	probably null
R6268:Cars2	UTSW	8	11529599	frame shift	probably null
R6841:Cars2	UTSW	8	11516198	missense	probably benign	0.01
R7076:Cars2	UTSW	8	11529649	missense	probably damaging	1.00
R7586:Cars2	UTSW	8	11530321	nonsense	probably null
R8342:Cars2	UTSW	8	11529706	missense	probably damaging	1.00
R8962:Cars2	UTSW	8	11537304	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGACTTTACAGGCTGGAGTG -3'
(R):5'- CACATATTTTATAGCCTGAGGAGGG -3'

Sequencing Primer
(F):5'- TGGTATGGTCAGTATGGTAAGATAC -3'
(R):5'- CCTGAGGAGGGCTGCGG -3'

Posted On

2018-03-15