Mutagenetix > Incidental Mutation

Incidental Mutation 'R6267:Grip1'

507085

Institutional Source

Beutler Lab

Gene Symbol

Grip1

Ensembl Gene

ENSMUSG00000034813

Gene Name

glutamate receptor interacting protein 1

Synonyms

MMRRC Submission

044405-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6267 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119453830-120087261 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 120075464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 696 (Q696*)

Ref Sequence

ENSEMBL: ENSMUSP00000122349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000081260] [ENSMUST00000105261] [ENSMUST00000105262] [ENSMUST00000130387] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954] [ENSMUST00000154238]

AlphaFold

Q925T6

Predicted Effect

probably null
Transcript: ENSMUST00000041962
AA Change: Q1045*

SMART Domains

Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: Q1045*

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	354	367	N/A	INTRINSIC
low complexity region	388	405	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
PDZ	429	509	6.36e-17	SMART
PDZ	530	606	1.11e-16	SMART
PDZ	629	703	1.73e-18	SMART
PDZ	947	1019	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000077871
AA Change: Q1018*

SMART Domains

Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: Q1018*

Domain	Start	End	E-Value	Type
PDZ	36	110	4.86e-13	SMART
PDZ	134	212	6.4e-22	SMART
PDZ	235	310	1.97e-13	SMART
low complexity region	327	340	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
PDZ	402	482	6.36e-17	SMART
PDZ	503	579	1.11e-16	SMART
PDZ	602	676	1.73e-18	SMART
PDZ	920	992	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000081260
AA Change: Q616*

SMART Domains

Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813
AA Change: Q616*

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	3e-19	SMART
PDZ	166	242	5.2e-19	SMART
PDZ	265	339	8.4e-21	SMART
PDZ	518	590	1.4e-15	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105261
AA Change: Q616*

SMART Domains

Protein: ENSMUSP00000100896
Gene: ENSMUSG00000034813
AA Change: Q616*

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	6.36e-17	SMART
PDZ	166	242	1.11e-16	SMART
PDZ	265	339	1.73e-18	SMART
PDZ	518	590	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105262
AA Change: Q1044*

SMART Domains

Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: Q1044*

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	946	1018	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127787

Predicted Effect

probably null
Transcript: ENSMUST00000130387
AA Change: Q681*

SMART Domains

Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813
AA Change: Q681*

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	6.36e-17	SMART
PDZ	166	242	1.11e-16	SMART
PDZ	265	339	1.73e-18	SMART
PDZ	583	655	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000138410
AA Change: Q1111*

SMART Domains

Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: Q1111*

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	1013	1085	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139352

Predicted Effect

probably null
Transcript: ENSMUST00000144825
AA Change: Q1017*

SMART Domains

Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: Q1017*

Domain	Start	End	E-Value	Type
PDZ	35	109	4.86e-13	SMART
PDZ	133	211	6.4e-22	SMART
PDZ	234	309	1.97e-13	SMART
low complexity region	326	339	N/A	INTRINSIC
low complexity region	360	377	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
PDZ	401	481	6.36e-17	SMART
PDZ	502	578	1.11e-16	SMART
PDZ	601	675	1.73e-18	SMART
PDZ	919	991	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000144959
AA Change: Q1096*

SMART Domains

Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: Q1096*

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000147356
AA Change: Q1097*

SMART Domains

Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: Q1097*

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	394	422	N/A	INTRINSIC
low complexity region	440	457	N/A	INTRINSIC
low complexity region	465	476	N/A	INTRINSIC
PDZ	481	561	6.36e-17	SMART
PDZ	582	658	1.11e-16	SMART
PDZ	681	755	1.73e-18	SMART
PDZ	999	1071	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000147454
AA Change: Q1096*

SMART Domains

Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: Q1096*

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000148954
AA Change: Q1059*

SMART Domains

Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: Q1059*

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	961	1033	2.79e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000154238
AA Change: Q696*

SMART Domains

Protein: ENSMUSP00000122349
Gene: ENSMUSG00000034813
AA Change: Q696*

Domain	Start	End	E-Value	Type
low complexity region	49	60	N/A	INTRINSIC
PDZ	65	145	6.36e-17	SMART
PDZ	166	242	1.11e-16	SMART
PDZ	265	339	1.73e-18	SMART
PDZ	598	670	2.79e-13	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Abi3bp	A	G	16: 56,594,497	T341A	probably damaging	Het
Acer2	T	C	4: 86,874,586	F33S	probably damaging	Het
Actr1b	A	G	1: 36,701,163	V299A	possibly damaging	Het
Ampd3	T	A	7: 110,791,180		probably null	Het
Atm	A	C	9: 53,444,000	I2898R	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Chd2	T	C	7: 73,463,671	E1187G	probably damaging	Het
Cntrl	T	C	2: 35,129,793	L544P	probably damaging	Het
Cryga	A	C	1: 65,103,010	S75A	probably benign	Het
Dcbld1	T	A	10: 52,319,480	Y261*	probably null	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dst	A	C	1: 34,228,672	D5065A	probably damaging	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Eif4enif1	T	A	11: 3,227,793	V395E	probably damaging	Het
Enox1	A	G	14: 77,577,764	T121A	probably damaging	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Fcrl5	G	A	3: 87,448,324	G448E	probably damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Garnl3	T	C	2: 33,104,880	D39G	probably benign	Het
Gm14295	C	T	2: 176,808,989	Q91*	probably null	Het
Grb10	T	A	11: 11,970,639		probably benign	Het
Herc2	T	A	7: 56,153,166	C2112*	probably null	Het
Herc2	T	G	7: 56,204,718	L3797R	possibly damaging	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kif13b	A	G	14: 64,738,634	Y466C	probably damaging	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lingo4	G	A	3: 94,403,390	G545E	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lor	C	A	3: 92,081,812	G56*	probably null	Het
Lrfn1	A	G	7: 28,459,744	R363G	probably benign	Het
Lrp1b	T	C	2: 40,657,525	D446G	probably benign	Het
Ltbp1	G	T	17: 75,005,989	G35V	possibly damaging	Het
Magel2	G	A	7: 62,378,679	V444M	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Ms4a7	A	T	19: 11,333,295	I20N	possibly damaging	Het
Myo5b	A	G	18: 74,616,991	Y173C	probably damaging	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nmnat2	A	T	1: 153,076,971	H102L	probably damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr686	G	A	7: 105,203,392	T317I	probably damaging	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Pitpnm1	T	C	19: 4,110,522	L781P	probably damaging	Het
Prdm14	A	T	1: 13,118,936	C395S	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rorb	C	A	19: 18,977,857	V47L	possibly damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Sdr16c5	C	T	4: 4,016,162	G88E	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Slc52a3	G	T	2: 152,007,609		probably null	Het
Smco1	A	T	16: 32,274,014	M168L	probably benign	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Tmem225	T	A	9: 40,148,435	I37N	probably damaging	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Usp16	A	G	16: 87,483,191	N813S	probably benign	Het
Vmn1r128	A	T	7: 21,350,296	*308C	probably null	Het
Vmn2r45	A	G	7: 8,472,208	V607A	probably benign	Het
Vmn2r63	A	T	7: 42,928,635		probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Grip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Grip1	APN	10	119931302	nonsense	probably null
IGL01374:Grip1	APN	10	120049368	missense	probably benign	0.03
IGL01592:Grip1	APN	10	119930003	missense	probably damaging	1.00
IGL02207:Grip1	APN	10	120075309	missense	probably damaging	1.00
IGL02222:Grip1	APN	10	119999809	missense	probably damaging	1.00
IGL02225:Grip1	APN	10	120049453	missense	probably damaging	1.00
IGL02447:Grip1	APN	10	120020071	missense	probably damaging	1.00
IGL02492:Grip1	APN	10	119930040	splice site	probably benign
IGL02522:Grip1	APN	10	119931249	missense	probably damaging	1.00
IGL02574:Grip1	APN	10	119942913	missense	probably damaging	1.00
IGL02718:Grip1	APN	10	120075515	makesense	probably null
IGL02751:Grip1	APN	10	119978577	missense	probably benign	0.08
IGL03221:Grip1	APN	10	119986394	missense	probably benign	0.00
IGL03377:Grip1	APN	10	120055032	missense	probably damaging	0.98
PIT4403001:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R0304:Grip1	UTSW	10	120075471	missense	probably benign	0.31
R0681:Grip1	UTSW	10	120010230	missense	probably damaging	1.00
R0760:Grip1	UTSW	10	120018078	missense	probably damaging	0.96
R1457:Grip1	UTSW	10	119986350	missense	possibly damaging	0.73
R1506:Grip1	UTSW	10	119978451	missense	probably damaging	1.00
R1541:Grip1	UTSW	10	120000543	missense	probably damaging	0.99
R1553:Grip1	UTSW	10	120054851	missense	probably damaging	1.00
R1709:Grip1	UTSW	10	119897715	missense	probably damaging	0.98
R2055:Grip1	UTSW	10	120049511	splice site	probably benign
R2059:Grip1	UTSW	10	120038698	missense	possibly damaging	0.80
R2261:Grip1	UTSW	10	119985584	missense	probably benign	0.00
R2475:Grip1	UTSW	10	119978496	missense	probably benign	0.01
R3777:Grip1	UTSW	10	119985630	critical splice donor site	probably null
R3849:Grip1	UTSW	10	119929958	missense	probably damaging	1.00
R3956:Grip1	UTSW	10	119930026	missense	probably damaging	1.00
R4643:Grip1	UTSW	10	120020101	missense	probably damaging	1.00
R4693:Grip1	UTSW	10	120000554	missense	probably benign	0.10
R4724:Grip1	UTSW	10	120038683	missense	probably benign	0.02
R4843:Grip1	UTSW	10	119930015	missense	probably damaging	1.00
R4884:Grip1	UTSW	10	120075306	missense	probably damaging	1.00
R4912:Grip1	UTSW	10	119931248	missense	probably damaging	1.00
R5185:Grip1	UTSW	10	119931259	missense	probably benign	0.37
R5291:Grip1	UTSW	10	120086969	missense	probably benign	0.04
R5293:Grip1	UTSW	10	119897735	missense	probably damaging	0.99
R5296:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R5302:Grip1	UTSW	10	120020077	missense	probably damaging	1.00
R5541:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R5792:Grip1	UTSW	10	119985480	missense	probably benign	0.07
R5861:Grip1	UTSW	10	119929970	missense	probably damaging	1.00
R5905:Grip1	UTSW	10	119985492	missense	probably benign	0.02
R5949:Grip1	UTSW	10	120050242	missense	probably benign	0.00
R6112:Grip1	UTSW	10	119993232	missense	probably benign	0.00
R6166:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R6167:Grip1	UTSW	10	119897797	critical splice donor site	probably null
R6193:Grip1	UTSW	10	120038314	missense	probably damaging	1.00
R6218:Grip1	UTSW	10	119986346	missense	possibly damaging	0.95
R6296:Grip1	UTSW	10	120075464	nonsense	probably null
R6490:Grip1	UTSW	10	119986424	missense	possibly damaging	0.82
R6543:Grip1	UTSW	10	119985594	missense	probably benign	0.00
R6558:Grip1	UTSW	10	119454383	missense	probably benign	0.00
R6995:Grip1	UTSW	10	119986470	missense	probably damaging	0.99
R7122:Grip1	UTSW	10	120035374	missense	possibly damaging	0.48
R7157:Grip1	UTSW	10	119945156	missense	probably damaging	1.00
R7410:Grip1	UTSW	10	120020020	missense	probably benign	0.01
R7447:Grip1	UTSW	10	120086966	missense	probably benign	0.01
R7539:Grip1	UTSW	10	120054871	missense	probably benign	0.17
R7586:Grip1	UTSW	10	120077138	splice site	probably null
R7768:Grip1	UTSW	10	120038397	missense	probably damaging	0.98
R7831:Grip1	UTSW	10	120018106	missense	probably damaging	1.00
R7896:Grip1	UTSW	10	119978545	missense	possibly damaging	0.53
R8103:Grip1	UTSW	10	119978535	missense	probably benign	0.00
R8254:Grip1	UTSW	10	120054905	nonsense	probably null
R8688:Grip1	UTSW	10	119999904	missense	probably benign	0.12
R8823:Grip1	UTSW	10	119975951	missense
R8837:Grip1	UTSW	10	119930035	missense	probably damaging	1.00
R8885:Grip1	UTSW	10	119454287	start gained	probably benign
R8951:Grip1	UTSW	10	120038604	missense	possibly damaging	0.85
R9042:Grip1	UTSW	10	120000533	missense	probably benign	0.14
R9045:Grip1	UTSW	10	120035451	missense	probably damaging	0.97
R9237:Grip1	UTSW	10	120075405	missense	probably benign	0.07
R9254:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9259:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9260:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9307:Grip1	UTSW	10	119985549	missense	probably benign	0.01
R9379:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9546:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9547:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9548:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9549:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9583:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9584:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9610:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9611:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9612:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9684:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9687:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9690:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9691:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9742:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9744:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9752:Grip1	UTSW	10	120035351	missense	possibly damaging	0.46
R9758:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9762:Grip1	UTSW	10	119976001	missense	possibly damaging	0.92
R9764:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
RF011:Grip1	UTSW	10	119931315	missense	probably null	0.97
Z1176:Grip1	UTSW	10	119819483	unclassified	probably benign
Z1177:Grip1	UTSW	10	119986444	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CAGGTAAATCACGTGCGGAC -3'
(R):5'- CCCCTGTGCTTGCATTAATG -3'

Sequencing Primer
(F):5'- ACGAGAGACTTTGACTGCTGC -3'
(R):5'- GTGCTTCAGCTGTCACAGAAATC -3'

Posted On

2018-03-15