Incidental Mutation 'R6267:Cd300lf'
ID 507098
Institutional Source Beutler Lab
Gene Symbol Cd300lf
Ensembl Gene ENSMUSG00000047798
Gene Name CD300 molecule like family member F
Synonyms IREM1, IgSF13, F730004D16Rik, Pigr3, CLM-1, LMIR3, DIgR2
MMRRC Submission 044405-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115007040-115024818 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115015195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 132 (V132I)
Ref Sequence ENSEMBL: ENSMUSP00000102171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051264] [ENSMUST00000067754] [ENSMUST00000106561] [ENSMUST00000106562]
AlphaFold Q6SJQ7
Predicted Effect probably benign
Transcript: ENSMUST00000051264
SMART Domains Protein: ENSMUSP00000053983
Gene: ENSMUSG00000047798

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 26 125 2.06e-5 SMART
low complexity region 131 154 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:SIT 187 293 1.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067754
SMART Domains Protein: ENSMUSP00000065016
Gene: ENSMUSG00000020732

DomainStartEndE-ValueType
RAB 23 187 1.27e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106561
AA Change: V132I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102171
Gene: ENSMUSG00000047798
AA Change: V132I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 26 125 2.06e-5 SMART
low complexity region 130 155 N/A INTRINSIC
low complexity region 170 191 N/A INTRINSIC
Pfam:SIT 194 299 3.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106562
SMART Domains Protein: ENSMUSP00000102172
Gene: ENSMUSG00000047798

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 26 125 2.06e-5 SMART
low complexity region 127 150 N/A INTRINSIC
Pfam:SIT 153 259 7.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131046
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD300 protein family. Members of this family are cell surface glycoproteins with a single IgV-like extracellular domain, and are involved in the regulation of immune response. The encoded protein is an inhibitory receptor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased severity of experimental autoimmune encephalomyelitis with increased demyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,086,580 (GRCm39) K277R probably damaging Het
Aatf T C 11: 84,363,926 (GRCm39) Y267C probably benign Het
Abi3bp A G 16: 56,414,860 (GRCm39) T341A probably damaging Het
Acer2 T C 4: 86,792,823 (GRCm39) F33S probably damaging Het
Actr1b A G 1: 36,740,244 (GRCm39) V299A possibly damaging Het
Ampd3 T A 7: 110,390,387 (GRCm39) probably null Het
Atm A C 9: 53,355,300 (GRCm39) I2898R probably damaging Het
Bpifb6 G C 2: 153,748,812 (GRCm39) K269N possibly damaging Het
Cacna1c T C 6: 118,575,684 (GRCm39) E1927G possibly damaging Het
Cacna1c T A 6: 118,629,675 (GRCm39) T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,579,599 (GRCm39) probably null Het
Cbll1 A G 12: 31,537,507 (GRCm39) V415A probably benign Het
Chd2 T C 7: 73,113,419 (GRCm39) E1187G probably damaging Het
Cntrl T C 2: 35,019,805 (GRCm39) L544P probably damaging Het
Cryga A C 1: 65,142,169 (GRCm39) S75A probably benign Het
Dcbld1 T A 10: 52,195,576 (GRCm39) Y261* probably null Het
Ddx11 G A 17: 66,457,724 (GRCm39) probably null Het
Dgke C T 11: 88,931,575 (GRCm39) V560I probably benign Het
Dst A C 1: 34,267,753 (GRCm39) D5065A probably damaging Het
Dusp16 C A 6: 134,697,456 (GRCm39) probably null Het
Eif4enif1 T A 11: 3,177,793 (GRCm39) V395E probably damaging Het
Enox1 A G 14: 77,815,204 (GRCm39) T121A probably damaging Het
Enpp4 G T 17: 44,413,371 (GRCm39) N54K probably benign Het
Erc2 A T 14: 27,802,112 (GRCm39) K764M probably damaging Het
Ercc6 G T 14: 32,248,360 (GRCm39) E304* probably null Het
Fam117a T A 11: 95,254,971 (GRCm39) C115S possibly damaging Het
Fcrl5 G A 3: 87,355,631 (GRCm39) G448E probably damaging Het
Galntl5 T C 5: 25,391,163 (GRCm39) S21P probably benign Het
Garnl3 T C 2: 32,994,892 (GRCm39) D39G probably benign Het
Gm14295 C T 2: 176,500,782 (GRCm39) Q91* probably null Het
Grb10 T A 11: 11,920,639 (GRCm39) probably benign Het
Grip1 C T 10: 119,911,369 (GRCm39) Q696* probably null Het
Herc2 T A 7: 55,802,914 (GRCm39) C2112* probably null Het
Herc2 T G 7: 55,854,466 (GRCm39) L3797R possibly damaging Het
Ighm T C 12: 113,385,187 (GRCm39) I258V unknown Het
Jarid2 T A 13: 45,056,539 (GRCm39) Y443N possibly damaging Het
Kif13b A G 14: 64,976,083 (GRCm39) Y466C probably damaging Het
Krtap4-6 T A 11: 99,556,245 (GRCm39) R161* probably null Het
Lingo4 G A 3: 94,310,697 (GRCm39) G545E probably benign Het
Lmo2 T G 2: 103,800,946 (GRCm39) V39G possibly damaging Het
Loricrin C A 3: 91,989,119 (GRCm39) G56* probably null Het
Lrfn1 A G 7: 28,159,169 (GRCm39) R363G probably benign Het
Lrp1b T C 2: 40,547,537 (GRCm39) D446G probably benign Het
Ltbp1 G T 17: 75,312,984 (GRCm39) G35V possibly damaging Het
Magel2 G A 7: 62,028,427 (GRCm39) V444M probably damaging Het
Mkx A T 18: 7,000,591 (GRCm39) probably null Het
Ms4a7 A T 19: 11,310,659 (GRCm39) I20N possibly damaging Het
Myo5b A G 18: 74,750,062 (GRCm39) Y173C probably damaging Het
Nek1 C T 8: 61,525,343 (GRCm39) Q594* probably null Het
Nipbl T C 15: 8,330,379 (GRCm39) M2349V possibly damaging Het
Nmnat2 A T 1: 152,952,717 (GRCm39) H102L probably damaging Het
Nup155 T A 15: 8,182,639 (GRCm39) C1201S probably damaging Het
Or2y8 C A 11: 52,035,423 (GRCm39) R311S probably benign Het
Or4a76 G A 2: 89,460,975 (GRCm39) T89I probably damaging Het
Or52x1 G A 7: 104,852,599 (GRCm39) T317I probably damaging Het
Osbpl1a A G 18: 12,952,560 (GRCm39) probably null Het
Pcnt A G 10: 76,221,632 (GRCm39) V1998A probably benign Het
Pitpnc1 T C 11: 107,117,092 (GRCm39) H193R probably damaging Het
Pitpnm1 T C 19: 4,160,522 (GRCm39) L781P probably damaging Het
Prdm14 A T 1: 13,189,160 (GRCm39) C395S probably damaging Het
Prmt8 A G 6: 127,688,767 (GRCm39) I201T probably damaging Het
Pter T C 2: 12,983,352 (GRCm39) V119A probably damaging Het
Rab11fip4 T C 11: 79,581,655 (GRCm39) probably null Het
Rgs9 T C 11: 109,159,813 (GRCm39) N173S probably benign Het
Rorb C A 19: 18,955,221 (GRCm39) V47L possibly damaging Het
Rtn4r A G 16: 17,969,046 (GRCm39) Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 (GRCm39) G88E probably damaging Het
Sfxn1 C T 13: 54,247,899 (GRCm39) T208I probably benign Het
Sgo2b C T 8: 64,380,827 (GRCm39) M668I probably benign Het
Slc52a3 G T 2: 151,849,529 (GRCm39) probably null Het
Smco1 A T 16: 32,092,832 (GRCm39) M168L probably benign Het
Spata31d1d G A 13: 59,876,278 (GRCm39) T419I possibly damaging Het
Spata31d1e T C 13: 59,890,497 (GRCm39) D441G probably benign Het
Spink5 T C 18: 44,147,824 (GRCm39) S857P probably damaging Het
Stk35 T A 2: 129,652,808 (GRCm39) Y436* probably null Het
Tmem225 T A 9: 40,059,731 (GRCm39) I37N probably damaging Het
Unkl T C 17: 25,450,839 (GRCm39) *232R probably null Het
Usp16 A G 16: 87,280,079 (GRCm39) N813S probably benign Het
Vmn1r128 A T 7: 21,084,221 (GRCm39) *308C probably null Het
Vmn2r45 A G 7: 8,475,207 (GRCm39) V607A probably benign Het
Vmn2r63 A T 7: 42,578,059 (GRCm39) probably null Het
Wnk4 A T 11: 101,164,824 (GRCm39) N718Y probably damaging Het
Zfp503 G C 14: 22,035,868 (GRCm39) Y349* probably null Het
Zfp990 T A 4: 145,264,673 (GRCm39) F557Y possibly damaging Het
Other mutations in Cd300lf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Cd300lf APN 11 115,015,159 (GRCm39) missense probably benign 0.34
IGL01364:Cd300lf APN 11 115,017,176 (GRCm39) missense probably benign 0.16
IGL01419:Cd300lf APN 11 115,017,180 (GRCm39) missense probably benign 0.32
IGL01812:Cd300lf APN 11 115,011,114 (GRCm39) missense probably damaging 0.98
IGL03217:Cd300lf APN 11 115,015,117 (GRCm39) missense possibly damaging 0.80
R1889:Cd300lf UTSW 11 115,011,206 (GRCm39) missense probably benign 0.01
R3899:Cd300lf UTSW 11 115,015,177 (GRCm39) missense probably damaging 1.00
R4180:Cd300lf UTSW 11 115,015,089 (GRCm39) missense possibly damaging 0.55
R5362:Cd300lf UTSW 11 115,007,940 (GRCm39) missense probably damaging 1.00
R5865:Cd300lf UTSW 11 115,017,126 (GRCm39) missense probably damaging 0.99
R6296:Cd300lf UTSW 11 115,015,195 (GRCm39) missense probably benign 0.05
R8920:Cd300lf UTSW 11 115,017,180 (GRCm39) missense probably benign 0.32
R8946:Cd300lf UTSW 11 115,024,738 (GRCm39) start gained probably benign
R9380:Cd300lf UTSW 11 115,015,153 (GRCm39) missense probably benign 0.09
R9548:Cd300lf UTSW 11 115,007,858 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGACTGTCGGAAGAGTTTGGC -3'
(R):5'- CCTGAGACTTTGTTCCAGCC -3'

Sequencing Primer
(F):5'- ACTGTCGGAAGAGTTTGGCCTAAC -3'
(R):5'- AGGCTCCGGCTTCTCTTAGAG -3'
Posted On 2018-03-15