Incidental Mutation 'R6267:Ighm'
ID507100
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Nameimmunoglobulin heavy constant mu
SynonymsmuH, IgM, Igh6, Igh-M, Ig mu
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6267 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location113418558-113422730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113421567 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 258 (I258V)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103426
AA Change: I258V
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617
AA Change: I258V

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175007
Predicted Effect unknown
Transcript: ENSMUST00000177715
AA Change: I258V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196624
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113421234 unclassified probably benign
IGL01775:Ighm APN 12 113422467 missense unknown
IGL02069:Ighm APN 12 113421148 unclassified probably benign
IGL03124:Ighm APN 12 113421638 missense unknown
manifest UTSW 12 113421253 nonsense probably null
R3055:Ighm UTSW 12 113418976 unclassified probably benign
R3056:Ighm UTSW 12 113418976 unclassified probably benign
R4164:Ighm UTSW 12 113422295 missense unknown
R4475:Ighm UTSW 12 113420893 unclassified probably benign
R4871:Ighm UTSW 12 113421621 missense unknown
R5542:Ighm UTSW 12 113418981 unclassified probably benign
R5738:Ighm UTSW 12 113421495 missense unknown
R5856:Ighm UTSW 12 113421602 missense unknown
R5946:Ighm UTSW 12 113422709 missense unknown
R6296:Ighm UTSW 12 113421567 missense unknown
R7409:Ighm UTSW 12 113422232 missense
R7492:Ighm UTSW 12 113422673 missense
R7898:Ighm UTSW 12 113421253 nonsense probably null
R8089:Ighm UTSW 12 113421234 unclassified probably benign
R8301:Ighm UTSW 12 113421545 missense
R8444:Ighm UTSW 12 113421193 missense
Predicted Primers PCR Primer
(F):5'- TCTTCTGTGGTGAAGGCAGATC -3'
(R):5'- ACCAGCATCTTCCCTTAAGTAG -3'

Sequencing Primer
(F):5'- TGAAGGCAGATCCCTGTGAGTC -3'
(R):5'- CAGCATCTTCCCTTAAGTAGGTTTGG -3'
Posted On2018-03-15