Incidental Mutation 'R6267:Usp16'
ID 507115
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Name ubiquitin specific peptidase 16
Synonyms 2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 87454703-87483517 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87483191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 813 (N813S)
Ref Sequence ENSEMBL: ENSMUSP00000026710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000177376]
AlphaFold Q99LG0
Predicted Effect probably benign
Transcript: ENSMUST00000026704
SMART Domains Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 529 6.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026710
AA Change: N813S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: N813S

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119504
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135399
Predicted Effect probably benign
Transcript: ENSMUST00000144759
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149656
Predicted Effect probably benign
Transcript: ENSMUST00000175750
SMART Domains Protein: ENSMUSP00000134920
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 238 1.2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175977
SMART Domains Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 132 4.5e-32 PFAM
Pfam:Cpn60_TCP1 120 470 1.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177275
Predicted Effect probably benign
Transcript: ENSMUST00000177376
SMART Domains Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
PDB:4B2T|Q 1 51 1e-29 PDB
SCOP:d1oela1 26 51 8e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177485
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87466276 missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87479183 missense probably benign 0.00
IGL02570:Usp16 APN 16 87480893 missense probably damaging 1.00
IGL02736:Usp16 APN 16 87464835 missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87479739 missense probably damaging 1.00
IGL03066:Usp16 APN 16 87471833 missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87473132 missense probably damaging 0.99
R0395:Usp16 UTSW 16 87475446 missense probably damaging 1.00
R0619:Usp16 UTSW 16 87472164 missense probably benign 0.02
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87464834 missense probably damaging 1.00
R1557:Usp16 UTSW 16 87462142 critical splice donor site probably null
R1776:Usp16 UTSW 16 87479316 missense probably damaging 0.97
R1818:Usp16 UTSW 16 87479132 nonsense probably null
R1835:Usp16 UTSW 16 87480907 missense probably damaging 1.00
R2022:Usp16 UTSW 16 87473126 missense probably damaging 1.00
R2146:Usp16 UTSW 16 87473187 critical splice donor site probably null
R2432:Usp16 UTSW 16 87466358 critical splice donor site probably null
R3110:Usp16 UTSW 16 87471848 splice site probably null
R3112:Usp16 UTSW 16 87471848 splice site probably null
R3771:Usp16 UTSW 16 87458683 start codon destroyed probably null 1.00
R4353:Usp16 UTSW 16 87470354 missense probably damaging 1.00
R4959:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R4973:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R5276:Usp16 UTSW 16 87470451 critical splice donor site probably null
R5753:Usp16 UTSW 16 87482899 missense probably damaging 0.98
R6230:Usp16 UTSW 16 87464798 missense possibly damaging 0.48
R6473:Usp16 UTSW 16 87483135 missense probably benign 0.00
R6736:Usp16 UTSW 16 87470397 missense probably damaging 1.00
R7006:Usp16 UTSW 16 87471836 missense probably damaging 1.00
R7012:Usp16 UTSW 16 87458744 critical splice donor site probably null
R7040:Usp16 UTSW 16 87480929 missense probably damaging 1.00
R7136:Usp16 UTSW 16 87483171 missense probably benign
R7295:Usp16 UTSW 16 87472089 missense probably benign 0.44
R7434:Usp16 UTSW 16 87479319 nonsense probably null
R7497:Usp16 UTSW 16 87466286 nonsense probably null
R7571:Usp16 UTSW 16 87464835 missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87479300 missense probably benign 0.34
R7624:Usp16 UTSW 16 87476805 missense probably benign 0.23
R7889:Usp16 UTSW 16 87474584 missense probably benign 0.44
R8499:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R8779:Usp16 UTSW 16 87479409 missense probably benign 0.00
R9182:Usp16 UTSW 16 87479654 missense probably benign 0.00
R9251:Usp16 UTSW 16 87469752 missense probably benign 0.08
R9367:Usp16 UTSW 16 87464781 missense probably benign 0.01
X0061:Usp16 UTSW 16 87479457 missense probably benign 0.01
X0064:Usp16 UTSW 16 87471725 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGGTGACATTCCACAAGG -3'
(R):5'- CAGTATGCTAATACAAAACCGCTG -3'

Sequencing Primer
(F):5'- AGGTAAGCTATCTTGGATACTCCGC -3'
(R):5'- ACCGCTGTAAATTATTTTGCCTG -3'
Posted On 2018-03-15