Incidental Mutation 'R6267:Usp16'
ID 507115
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Name ubiquitin specific peptidase 16
Synonyms 2810483I07Rik, 6330514E22Rik, UBP-M, 1200004E02Rik
MMRRC Submission 044405-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 87251833-87280403 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87280079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 813 (N813S)
Ref Sequence ENSEMBL: ENSMUSP00000026710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000177376]
AlphaFold Q99LG0
Predicted Effect probably benign
Transcript: ENSMUST00000026704
SMART Domains Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 529 6.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026710
AA Change: N813S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: N813S

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119504
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135399
Predicted Effect probably benign
Transcript: ENSMUST00000144759
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176241
Predicted Effect probably benign
Transcript: ENSMUST00000175977
SMART Domains Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 132 4.5e-32 PFAM
Pfam:Cpn60_TCP1 120 470 1.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177376
SMART Domains Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
PDB:4B2T|Q 1 51 1e-29 PDB
SCOP:d1oela1 26 51 8e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149656
Predicted Effect probably benign
Transcript: ENSMUST00000175750
SMART Domains Protein: ENSMUSP00000134920
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 238 1.2e-69 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,086,580 (GRCm39) K277R probably damaging Het
Aatf T C 11: 84,363,926 (GRCm39) Y267C probably benign Het
Abi3bp A G 16: 56,414,860 (GRCm39) T341A probably damaging Het
Acer2 T C 4: 86,792,823 (GRCm39) F33S probably damaging Het
Actr1b A G 1: 36,740,244 (GRCm39) V299A possibly damaging Het
Ampd3 T A 7: 110,390,387 (GRCm39) probably null Het
Atm A C 9: 53,355,300 (GRCm39) I2898R probably damaging Het
Bpifb6 G C 2: 153,748,812 (GRCm39) K269N possibly damaging Het
Cacna1c T C 6: 118,575,684 (GRCm39) E1927G possibly damaging Het
Cacna1c T A 6: 118,629,675 (GRCm39) T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,579,599 (GRCm39) probably null Het
Cbll1 A G 12: 31,537,507 (GRCm39) V415A probably benign Het
Cd300lf C T 11: 115,015,195 (GRCm39) V132I probably benign Het
Chd2 T C 7: 73,113,419 (GRCm39) E1187G probably damaging Het
Cntrl T C 2: 35,019,805 (GRCm39) L544P probably damaging Het
Cryga A C 1: 65,142,169 (GRCm39) S75A probably benign Het
Dcbld1 T A 10: 52,195,576 (GRCm39) Y261* probably null Het
Ddx11 G A 17: 66,457,724 (GRCm39) probably null Het
Dgke C T 11: 88,931,575 (GRCm39) V560I probably benign Het
Dst A C 1: 34,267,753 (GRCm39) D5065A probably damaging Het
Dusp16 C A 6: 134,697,456 (GRCm39) probably null Het
Eif4enif1 T A 11: 3,177,793 (GRCm39) V395E probably damaging Het
Enox1 A G 14: 77,815,204 (GRCm39) T121A probably damaging Het
Enpp4 G T 17: 44,413,371 (GRCm39) N54K probably benign Het
Erc2 A T 14: 27,802,112 (GRCm39) K764M probably damaging Het
Ercc6 G T 14: 32,248,360 (GRCm39) E304* probably null Het
Fam117a T A 11: 95,254,971 (GRCm39) C115S possibly damaging Het
Fcrl5 G A 3: 87,355,631 (GRCm39) G448E probably damaging Het
Galntl5 T C 5: 25,391,163 (GRCm39) S21P probably benign Het
Garnl3 T C 2: 32,994,892 (GRCm39) D39G probably benign Het
Gm14295 C T 2: 176,500,782 (GRCm39) Q91* probably null Het
Grb10 T A 11: 11,920,639 (GRCm39) probably benign Het
Grip1 C T 10: 119,911,369 (GRCm39) Q696* probably null Het
Herc2 T A 7: 55,802,914 (GRCm39) C2112* probably null Het
Herc2 T G 7: 55,854,466 (GRCm39) L3797R possibly damaging Het
Ighm T C 12: 113,385,187 (GRCm39) I258V unknown Het
Jarid2 T A 13: 45,056,539 (GRCm39) Y443N possibly damaging Het
Kif13b A G 14: 64,976,083 (GRCm39) Y466C probably damaging Het
Krtap4-6 T A 11: 99,556,245 (GRCm39) R161* probably null Het
Lingo4 G A 3: 94,310,697 (GRCm39) G545E probably benign Het
Lmo2 T G 2: 103,800,946 (GRCm39) V39G possibly damaging Het
Loricrin C A 3: 91,989,119 (GRCm39) G56* probably null Het
Lrfn1 A G 7: 28,159,169 (GRCm39) R363G probably benign Het
Lrp1b T C 2: 40,547,537 (GRCm39) D446G probably benign Het
Ltbp1 G T 17: 75,312,984 (GRCm39) G35V possibly damaging Het
Magel2 G A 7: 62,028,427 (GRCm39) V444M probably damaging Het
Mkx A T 18: 7,000,591 (GRCm39) probably null Het
Ms4a7 A T 19: 11,310,659 (GRCm39) I20N possibly damaging Het
Myo5b A G 18: 74,750,062 (GRCm39) Y173C probably damaging Het
Nek1 C T 8: 61,525,343 (GRCm39) Q594* probably null Het
Nipbl T C 15: 8,330,379 (GRCm39) M2349V possibly damaging Het
Nmnat2 A T 1: 152,952,717 (GRCm39) H102L probably damaging Het
Nup155 T A 15: 8,182,639 (GRCm39) C1201S probably damaging Het
Or2y8 C A 11: 52,035,423 (GRCm39) R311S probably benign Het
Or4a76 G A 2: 89,460,975 (GRCm39) T89I probably damaging Het
Or52x1 G A 7: 104,852,599 (GRCm39) T317I probably damaging Het
Osbpl1a A G 18: 12,952,560 (GRCm39) probably null Het
Pcnt A G 10: 76,221,632 (GRCm39) V1998A probably benign Het
Pitpnc1 T C 11: 107,117,092 (GRCm39) H193R probably damaging Het
Pitpnm1 T C 19: 4,160,522 (GRCm39) L781P probably damaging Het
Prdm14 A T 1: 13,189,160 (GRCm39) C395S probably damaging Het
Prmt8 A G 6: 127,688,767 (GRCm39) I201T probably damaging Het
Pter T C 2: 12,983,352 (GRCm39) V119A probably damaging Het
Rab11fip4 T C 11: 79,581,655 (GRCm39) probably null Het
Rgs9 T C 11: 109,159,813 (GRCm39) N173S probably benign Het
Rorb C A 19: 18,955,221 (GRCm39) V47L possibly damaging Het
Rtn4r A G 16: 17,969,046 (GRCm39) Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 (GRCm39) G88E probably damaging Het
Sfxn1 C T 13: 54,247,899 (GRCm39) T208I probably benign Het
Sgo2b C T 8: 64,380,827 (GRCm39) M668I probably benign Het
Slc52a3 G T 2: 151,849,529 (GRCm39) probably null Het
Smco1 A T 16: 32,092,832 (GRCm39) M168L probably benign Het
Spata31d1d G A 13: 59,876,278 (GRCm39) T419I possibly damaging Het
Spata31d1e T C 13: 59,890,497 (GRCm39) D441G probably benign Het
Spink5 T C 18: 44,147,824 (GRCm39) S857P probably damaging Het
Stk35 T A 2: 129,652,808 (GRCm39) Y436* probably null Het
Tmem225 T A 9: 40,059,731 (GRCm39) I37N probably damaging Het
Unkl T C 17: 25,450,839 (GRCm39) *232R probably null Het
Vmn1r128 A T 7: 21,084,221 (GRCm39) *308C probably null Het
Vmn2r45 A G 7: 8,475,207 (GRCm39) V607A probably benign Het
Vmn2r63 A T 7: 42,578,059 (GRCm39) probably null Het
Wnk4 A T 11: 101,164,824 (GRCm39) N718Y probably damaging Het
Zfp503 G C 14: 22,035,868 (GRCm39) Y349* probably null Het
Zfp990 T A 4: 145,264,673 (GRCm39) F557Y possibly damaging Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87,263,164 (GRCm39) missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87,276,071 (GRCm39) missense probably benign 0.00
IGL02570:Usp16 APN 16 87,277,781 (GRCm39) missense probably damaging 1.00
IGL02736:Usp16 APN 16 87,261,723 (GRCm39) missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87,276,627 (GRCm39) missense probably damaging 1.00
IGL03066:Usp16 APN 16 87,268,721 (GRCm39) missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87,270,020 (GRCm39) missense probably damaging 0.99
R0395:Usp16 UTSW 16 87,272,334 (GRCm39) missense probably damaging 1.00
R0619:Usp16 UTSW 16 87,269,052 (GRCm39) missense probably benign 0.02
R1146:Usp16 UTSW 16 87,271,536 (GRCm39) missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87,271,536 (GRCm39) missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87,261,722 (GRCm39) missense probably damaging 1.00
R1557:Usp16 UTSW 16 87,259,030 (GRCm39) critical splice donor site probably null
R1776:Usp16 UTSW 16 87,276,204 (GRCm39) missense probably damaging 0.97
R1818:Usp16 UTSW 16 87,276,020 (GRCm39) nonsense probably null
R1835:Usp16 UTSW 16 87,277,795 (GRCm39) missense probably damaging 1.00
R2022:Usp16 UTSW 16 87,270,014 (GRCm39) missense probably damaging 1.00
R2146:Usp16 UTSW 16 87,270,075 (GRCm39) critical splice donor site probably null
R2432:Usp16 UTSW 16 87,263,246 (GRCm39) critical splice donor site probably null
R3110:Usp16 UTSW 16 87,268,736 (GRCm39) splice site probably null
R3112:Usp16 UTSW 16 87,268,736 (GRCm39) splice site probably null
R3771:Usp16 UTSW 16 87,255,571 (GRCm39) start codon destroyed probably null 1.00
R4353:Usp16 UTSW 16 87,267,242 (GRCm39) missense probably damaging 1.00
R4959:Usp16 UTSW 16 87,277,802 (GRCm39) missense probably damaging 0.99
R4973:Usp16 UTSW 16 87,277,802 (GRCm39) missense probably damaging 0.99
R5276:Usp16 UTSW 16 87,267,339 (GRCm39) critical splice donor site probably null
R5753:Usp16 UTSW 16 87,279,787 (GRCm39) missense probably damaging 0.98
R6230:Usp16 UTSW 16 87,261,686 (GRCm39) missense possibly damaging 0.48
R6473:Usp16 UTSW 16 87,280,023 (GRCm39) missense probably benign 0.00
R6736:Usp16 UTSW 16 87,267,285 (GRCm39) missense probably damaging 1.00
R7006:Usp16 UTSW 16 87,268,724 (GRCm39) missense probably damaging 1.00
R7012:Usp16 UTSW 16 87,255,632 (GRCm39) critical splice donor site probably null
R7040:Usp16 UTSW 16 87,277,817 (GRCm39) missense probably damaging 1.00
R7136:Usp16 UTSW 16 87,280,059 (GRCm39) missense probably benign
R7295:Usp16 UTSW 16 87,268,977 (GRCm39) missense probably benign 0.44
R7434:Usp16 UTSW 16 87,276,207 (GRCm39) nonsense probably null
R7497:Usp16 UTSW 16 87,263,174 (GRCm39) nonsense probably null
R7571:Usp16 UTSW 16 87,261,723 (GRCm39) missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87,276,188 (GRCm39) missense probably benign 0.34
R7624:Usp16 UTSW 16 87,273,693 (GRCm39) missense probably benign 0.23
R7889:Usp16 UTSW 16 87,271,472 (GRCm39) missense probably benign 0.44
R8499:Usp16 UTSW 16 87,271,536 (GRCm39) missense possibly damaging 0.93
R8779:Usp16 UTSW 16 87,276,297 (GRCm39) missense probably benign 0.00
R9182:Usp16 UTSW 16 87,276,542 (GRCm39) missense probably benign 0.00
R9251:Usp16 UTSW 16 87,266,640 (GRCm39) missense probably benign 0.08
R9367:Usp16 UTSW 16 87,261,669 (GRCm39) missense probably benign 0.01
R9707:Usp16 UTSW 16 87,263,235 (GRCm39) missense probably benign
R9746:Usp16 UTSW 16 87,276,120 (GRCm39) missense probably benign 0.00
X0061:Usp16 UTSW 16 87,276,345 (GRCm39) missense probably benign 0.01
X0064:Usp16 UTSW 16 87,268,613 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGGTGACATTCCACAAGG -3'
(R):5'- CAGTATGCTAATACAAAACCGCTG -3'

Sequencing Primer
(F):5'- AGGTAAGCTATCTTGGATACTCCGC -3'
(R):5'- ACCGCTGTAAATTATTTTGCCTG -3'
Posted On 2018-03-15