Incidental Mutation 'R6267:Osbpl1a'
ID 507121
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Name oxysterol binding protein-like 1A
Synonyms G430090F17Rik, LOC328902
MMRRC Submission 044405-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 12888371-13074898 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12952560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119512] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000124570] [ENSMUST00000143077] [ENSMUST00000155650]
AlphaFold Q91XL9
Predicted Effect probably null
Transcript: ENSMUST00000074352
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117361
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118313
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119043
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119512
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121774
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121808
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121888
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124570
Predicted Effect probably null
Transcript: ENSMUST00000143077
SMART Domains Protein: ENSMUSP00000122967
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 184 3.5e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155650
SMART Domains Protein: ENSMUSP00000120439
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 13 46 N/A INTRINSIC
Pfam:Oxysterol_BP 131 187 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154614
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,086,580 (GRCm39) K277R probably damaging Het
Aatf T C 11: 84,363,926 (GRCm39) Y267C probably benign Het
Abi3bp A G 16: 56,414,860 (GRCm39) T341A probably damaging Het
Acer2 T C 4: 86,792,823 (GRCm39) F33S probably damaging Het
Actr1b A G 1: 36,740,244 (GRCm39) V299A possibly damaging Het
Ampd3 T A 7: 110,390,387 (GRCm39) probably null Het
Atm A C 9: 53,355,300 (GRCm39) I2898R probably damaging Het
Bpifb6 G C 2: 153,748,812 (GRCm39) K269N possibly damaging Het
Cacna1c T C 6: 118,575,684 (GRCm39) E1927G possibly damaging Het
Cacna1c T A 6: 118,629,675 (GRCm39) T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,579,599 (GRCm39) probably null Het
Cbll1 A G 12: 31,537,507 (GRCm39) V415A probably benign Het
Cd300lf C T 11: 115,015,195 (GRCm39) V132I probably benign Het
Chd2 T C 7: 73,113,419 (GRCm39) E1187G probably damaging Het
Cntrl T C 2: 35,019,805 (GRCm39) L544P probably damaging Het
Cryga A C 1: 65,142,169 (GRCm39) S75A probably benign Het
Dcbld1 T A 10: 52,195,576 (GRCm39) Y261* probably null Het
Ddx11 G A 17: 66,457,724 (GRCm39) probably null Het
Dgke C T 11: 88,931,575 (GRCm39) V560I probably benign Het
Dst A C 1: 34,267,753 (GRCm39) D5065A probably damaging Het
Dusp16 C A 6: 134,697,456 (GRCm39) probably null Het
Eif4enif1 T A 11: 3,177,793 (GRCm39) V395E probably damaging Het
Enox1 A G 14: 77,815,204 (GRCm39) T121A probably damaging Het
Enpp4 G T 17: 44,413,371 (GRCm39) N54K probably benign Het
Erc2 A T 14: 27,802,112 (GRCm39) K764M probably damaging Het
Ercc6 G T 14: 32,248,360 (GRCm39) E304* probably null Het
Fam117a T A 11: 95,254,971 (GRCm39) C115S possibly damaging Het
Fcrl5 G A 3: 87,355,631 (GRCm39) G448E probably damaging Het
Galntl5 T C 5: 25,391,163 (GRCm39) S21P probably benign Het
Garnl3 T C 2: 32,994,892 (GRCm39) D39G probably benign Het
Gm14295 C T 2: 176,500,782 (GRCm39) Q91* probably null Het
Grb10 T A 11: 11,920,639 (GRCm39) probably benign Het
Grip1 C T 10: 119,911,369 (GRCm39) Q696* probably null Het
Herc2 T A 7: 55,802,914 (GRCm39) C2112* probably null Het
Herc2 T G 7: 55,854,466 (GRCm39) L3797R possibly damaging Het
Ighm T C 12: 113,385,187 (GRCm39) I258V unknown Het
Jarid2 T A 13: 45,056,539 (GRCm39) Y443N possibly damaging Het
Kif13b A G 14: 64,976,083 (GRCm39) Y466C probably damaging Het
Krtap4-6 T A 11: 99,556,245 (GRCm39) R161* probably null Het
Lingo4 G A 3: 94,310,697 (GRCm39) G545E probably benign Het
Lmo2 T G 2: 103,800,946 (GRCm39) V39G possibly damaging Het
Loricrin C A 3: 91,989,119 (GRCm39) G56* probably null Het
Lrfn1 A G 7: 28,159,169 (GRCm39) R363G probably benign Het
Lrp1b T C 2: 40,547,537 (GRCm39) D446G probably benign Het
Ltbp1 G T 17: 75,312,984 (GRCm39) G35V possibly damaging Het
Magel2 G A 7: 62,028,427 (GRCm39) V444M probably damaging Het
Mkx A T 18: 7,000,591 (GRCm39) probably null Het
Ms4a7 A T 19: 11,310,659 (GRCm39) I20N possibly damaging Het
Myo5b A G 18: 74,750,062 (GRCm39) Y173C probably damaging Het
Nek1 C T 8: 61,525,343 (GRCm39) Q594* probably null Het
Nipbl T C 15: 8,330,379 (GRCm39) M2349V possibly damaging Het
Nmnat2 A T 1: 152,952,717 (GRCm39) H102L probably damaging Het
Nup155 T A 15: 8,182,639 (GRCm39) C1201S probably damaging Het
Or2y8 C A 11: 52,035,423 (GRCm39) R311S probably benign Het
Or4a76 G A 2: 89,460,975 (GRCm39) T89I probably damaging Het
Or52x1 G A 7: 104,852,599 (GRCm39) T317I probably damaging Het
Pcnt A G 10: 76,221,632 (GRCm39) V1998A probably benign Het
Pitpnc1 T C 11: 107,117,092 (GRCm39) H193R probably damaging Het
Pitpnm1 T C 19: 4,160,522 (GRCm39) L781P probably damaging Het
Prdm14 A T 1: 13,189,160 (GRCm39) C395S probably damaging Het
Prmt8 A G 6: 127,688,767 (GRCm39) I201T probably damaging Het
Pter T C 2: 12,983,352 (GRCm39) V119A probably damaging Het
Rab11fip4 T C 11: 79,581,655 (GRCm39) probably null Het
Rgs9 T C 11: 109,159,813 (GRCm39) N173S probably benign Het
Rorb C A 19: 18,955,221 (GRCm39) V47L possibly damaging Het
Rtn4r A G 16: 17,969,046 (GRCm39) Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 (GRCm39) G88E probably damaging Het
Sfxn1 C T 13: 54,247,899 (GRCm39) T208I probably benign Het
Sgo2b C T 8: 64,380,827 (GRCm39) M668I probably benign Het
Slc52a3 G T 2: 151,849,529 (GRCm39) probably null Het
Smco1 A T 16: 32,092,832 (GRCm39) M168L probably benign Het
Spata31d1d G A 13: 59,876,278 (GRCm39) T419I possibly damaging Het
Spata31d1e T C 13: 59,890,497 (GRCm39) D441G probably benign Het
Spink5 T C 18: 44,147,824 (GRCm39) S857P probably damaging Het
Stk35 T A 2: 129,652,808 (GRCm39) Y436* probably null Het
Tmem225 T A 9: 40,059,731 (GRCm39) I37N probably damaging Het
Unkl T C 17: 25,450,839 (GRCm39) *232R probably null Het
Usp16 A G 16: 87,280,079 (GRCm39) N813S probably benign Het
Vmn1r128 A T 7: 21,084,221 (GRCm39) *308C probably null Het
Vmn2r45 A G 7: 8,475,207 (GRCm39) V607A probably benign Het
Vmn2r63 A T 7: 42,578,059 (GRCm39) probably null Het
Wnk4 A T 11: 101,164,824 (GRCm39) N718Y probably damaging Het
Zfp503 G C 14: 22,035,868 (GRCm39) Y349* probably null Het
Zfp990 T A 4: 145,264,673 (GRCm39) F557Y possibly damaging Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12,890,683 (GRCm39) missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 13,038,132 (GRCm39) missense probably benign
IGL01450:Osbpl1a APN 18 13,004,152 (GRCm39) missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 13,066,638 (GRCm39) missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12,896,632 (GRCm39) missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12,889,271 (GRCm39) missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12,899,881 (GRCm39) missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12,974,370 (GRCm39) nonsense probably null
IGL02451:Osbpl1a APN 18 13,047,550 (GRCm39) splice site probably benign
IGL02490:Osbpl1a APN 18 13,015,341 (GRCm39) unclassified probably benign
IGL02884:Osbpl1a APN 18 12,952,635 (GRCm39) nonsense probably null
R0084:Osbpl1a UTSW 18 12,890,669 (GRCm39) missense probably benign 0.07
R0266:Osbpl1a UTSW 18 13,004,220 (GRCm39) splice site probably null
R0565:Osbpl1a UTSW 18 12,892,501 (GRCm39) missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 13,015,336 (GRCm39) critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12,890,747 (GRCm39) missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 13,015,251 (GRCm39) critical splice donor site probably null
R1464:Osbpl1a UTSW 18 13,047,615 (GRCm39) missense probably benign
R1464:Osbpl1a UTSW 18 13,047,615 (GRCm39) missense probably benign
R1475:Osbpl1a UTSW 18 12,890,737 (GRCm39) missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12,891,896 (GRCm39) missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12,921,373 (GRCm39) splice site probably null
R1930:Osbpl1a UTSW 18 13,038,251 (GRCm39) missense probably benign 0.04
R1931:Osbpl1a UTSW 18 13,038,251 (GRCm39) missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12,892,457 (GRCm39) missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 13,004,230 (GRCm39) missense probably benign 0.06
R2504:Osbpl1a UTSW 18 13,038,088 (GRCm39) missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12,899,956 (GRCm39) missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 13,004,129 (GRCm39) unclassified probably benign
R4306:Osbpl1a UTSW 18 12,952,652 (GRCm39) missense probably benign
R4835:Osbpl1a UTSW 18 12,901,593 (GRCm39) critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12,896,594 (GRCm39) missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12,895,697 (GRCm39) missense probably benign 0.12
R5224:Osbpl1a UTSW 18 13,066,753 (GRCm39) missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12,891,910 (GRCm39) missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 13,025,319 (GRCm39) missense probably benign 0.22
R5579:Osbpl1a UTSW 18 12,974,249 (GRCm39) missense probably damaging 1.00
R5833:Osbpl1a UTSW 18 12,921,419 (GRCm39) missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 13,038,138 (GRCm39) missense probably damaging 1.00
R6296:Osbpl1a UTSW 18 12,952,560 (GRCm39) critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12,889,318 (GRCm39) missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12,889,281 (GRCm39) missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12,900,020 (GRCm39) missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12,974,310 (GRCm39) nonsense probably null
R7154:Osbpl1a UTSW 18 12,901,649 (GRCm39) missense probably benign 0.00
R7459:Osbpl1a UTSW 18 13,066,642 (GRCm39) missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 13,066,657 (GRCm39) missense probably benign 0.44
R7797:Osbpl1a UTSW 18 13,015,321 (GRCm39) missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 13,047,578 (GRCm39) missense probably benign 0.01
R8084:Osbpl1a UTSW 18 13,038,099 (GRCm39) missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12,901,643 (GRCm39) missense probably benign 0.02
R8947:Osbpl1a UTSW 18 12,899,858 (GRCm39) critical splice donor site probably null
R9069:Osbpl1a UTSW 18 13,002,074 (GRCm39) intron probably benign
R9085:Osbpl1a UTSW 18 13,062,093 (GRCm39) missense probably damaging 1.00
R9288:Osbpl1a UTSW 18 12,904,402 (GRCm39) missense probably damaging 1.00
R9443:Osbpl1a UTSW 18 13,031,244 (GRCm39) missense probably benign 0.00
R9517:Osbpl1a UTSW 18 13,042,965 (GRCm39) missense probably benign
R9600:Osbpl1a UTSW 18 13,015,277 (GRCm39) missense probably benign 0.00
R9658:Osbpl1a UTSW 18 12,889,269 (GRCm39) missense probably benign 0.05
R9694:Osbpl1a UTSW 18 12,952,565 (GRCm39) missense probably benign 0.03
X0027:Osbpl1a UTSW 18 12,892,560 (GRCm39) missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 13,039,980 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGACACTTCCTGAAAGCCTG -3'
(R):5'- CATTCATCATGAGCCCGCTC -3'

Sequencing Primer
(F):5'- CCTGGGGGCTAAAACCAAGC -3'
(R):5'- TCTGCCACAGGTTCCGAGTC -3'
Posted On 2018-03-15