Mutagenetix > Incidental Mutation

Incidental Mutation 'R6267:Spink5'

507122

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6267 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44014757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 857 (S857P)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

AlphaFold

Q148R4

Predicted Effect

probably damaging
Transcript: ENSMUST00000069245
AA Change: S857P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: S857P

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Abi3bp	A	G	16: 56,594,497	T341A	probably damaging	Het
Acer2	T	C	4: 86,874,586	F33S	probably damaging	Het
Actr1b	A	G	1: 36,701,163	V299A	possibly damaging	Het
Ampd3	T	A	7: 110,791,180		probably null	Het
Atm	A	C	9: 53,444,000	I2898R	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Chd2	T	C	7: 73,463,671	E1187G	probably damaging	Het
Cntrl	T	C	2: 35,129,793	L544P	probably damaging	Het
Cryga	A	C	1: 65,103,010	S75A	probably benign	Het
Dcbld1	T	A	10: 52,319,480	Y261*	probably null	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dst	A	C	1: 34,228,672	D5065A	probably damaging	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Eif4enif1	T	A	11: 3,227,793	V395E	probably damaging	Het
Enox1	A	G	14: 77,577,764	T121A	probably damaging	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Fcrl5	G	A	3: 87,448,324	G448E	probably damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Garnl3	T	C	2: 33,104,880	D39G	probably benign	Het
Gm14295	C	T	2: 176,808,989	Q91*	probably null	Het
Grb10	T	A	11: 11,970,639		probably benign	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Herc2	T	A	7: 56,153,166	C2112*	probably null	Het
Herc2	T	G	7: 56,204,718	L3797R	possibly damaging	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kif13b	A	G	14: 64,738,634	Y466C	probably damaging	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lingo4	G	A	3: 94,403,390	G545E	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lor	C	A	3: 92,081,812	G56*	probably null	Het
Lrfn1	A	G	7: 28,459,744	R363G	probably benign	Het
Lrp1b	T	C	2: 40,657,525	D446G	probably benign	Het
Ltbp1	G	T	17: 75,005,989	G35V	possibly damaging	Het
Magel2	G	A	7: 62,378,679	V444M	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Ms4a7	A	T	19: 11,333,295	I20N	possibly damaging	Het
Myo5b	A	G	18: 74,616,991	Y173C	probably damaging	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nmnat2	A	T	1: 153,076,971	H102L	probably damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr686	G	A	7: 105,203,392	T317I	probably damaging	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Pitpnm1	T	C	19: 4,110,522	L781P	probably damaging	Het
Prdm14	A	T	1: 13,118,936	C395S	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rorb	C	A	19: 18,977,857	V47L	possibly damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Sdr16c5	C	T	4: 4,016,162	G88E	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Slc52a3	G	T	2: 152,007,609		probably null	Het
Smco1	A	T	16: 32,274,014	M168L	probably benign	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Tmem225	T	A	9: 40,148,435	I37N	probably damaging	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Usp16	A	G	16: 87,483,191	N813S	probably benign	Het
Vmn1r128	A	T	7: 21,350,296	*308C	probably null	Het
Vmn2r45	A	G	7: 8,472,208	V607A	probably benign	Het
Vmn2r63	A	T	7: 42,928,635		probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999934	splice site	probably benign
R0079:Spink5	UTSW	18	43977764	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	43990672	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7332:Spink5	UTSW	18	43982250	missense	probably damaging	0.96
R7396:Spink5	UTSW	18	43977655	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44010236	missense	probably benign	0.07
R8198:Spink5	UTSW	18	43992880	missense	probably benign	0.17
R8361:Spink5	UTSW	18	43989462	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	43990719	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44010238	missense	probably benign	0.02
R8749:Spink5	UTSW	18	43989358	nonsense	probably null
R8918:Spink5	UTSW	18	43967020	missense	probably damaging	0.98
R9064:Spink5	UTSW	18	43967126	missense	probably damaging	1.00
R9161:Spink5	UTSW	18	44014919	missense	probably damaging	1.00
R9221:Spink5	UTSW	18	43986300	missense	probably damaging	1.00
R9292:Spink5	UTSW	18	44015008	missense	possibly damaging	0.91
R9545:Spink5	UTSW	18	44003195	missense	possibly damaging	0.88
R9784:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTCTCCTTAGCTTAAGAGTGTG -3'
(R):5'- AAGGTTCCATCAGCACCACG -3'

Sequencing Primer
(F):5'- CCTTAGCTTAAGAGTGTGGAATTGTC -3'
(R):5'- ACCGGGTCATCTGTTTCTGGAC -3'

Posted On

2018-03-15