Incidental Mutation 'R6267:Pitpnm1'
ID507124
Institutional Source Beutler Lab
Gene Symbol Pitpnm1
Ensembl Gene ENSMUSG00000024851
Gene Namephosphatidylinositol transfer protein, membrane-associated 1
SynonymsDRES9, RdgB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6267 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4099998-4113965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4110522 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 781 (L781P)
Ref Sequence ENSEMBL: ENSMUSP00000097599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025767] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000117831] [ENSMUST00000121402]
Predicted Effect probably benign
Transcript: ENSMUST00000025767
SMART Domains Protein: ENSMUSP00000025767
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 5.3e-11 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000049658
AA Change: L781P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: L781P

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100022
AA Change: L781P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: L781P

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117831
SMART Domains Protein: ENSMUSP00000113807
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1e-10 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121402
SMART Domains Protein: ENSMUSP00000114096
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Abi3bp A G 16: 56,594,497 T341A probably damaging Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Pitpnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pitpnm1 APN 19 4110665 splice site probably null
IGL00978:Pitpnm1 APN 19 4101228 missense possibly damaging 0.61
IGL02039:Pitpnm1 APN 19 4105032 missense probably benign 0.01
IGL02122:Pitpnm1 APN 19 4107796 missense probably damaging 1.00
IGL02279:Pitpnm1 APN 19 4101207 missense probably damaging 1.00
IGL02316:Pitpnm1 APN 19 4112835 missense probably benign 0.16
IGL02434:Pitpnm1 APN 19 4103377 missense probably benign 0.00
R0926:Pitpnm1 UTSW 19 4112338 missense probably damaging 1.00
R1301:Pitpnm1 UTSW 19 4110831 splice site probably null
R1423:Pitpnm1 UTSW 19 4112392 missense probably damaging 1.00
R1592:Pitpnm1 UTSW 19 4106964 critical splice donor site probably null
R1733:Pitpnm1 UTSW 19 4109960 nonsense probably null
R1844:Pitpnm1 UTSW 19 4112395 missense probably damaging 1.00
R1971:Pitpnm1 UTSW 19 4112450 missense probably damaging 1.00
R1978:Pitpnm1 UTSW 19 4107973 splice site probably null
R2016:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2017:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2019:Pitpnm1 UTSW 19 4113641 missense probably damaging 1.00
R2210:Pitpnm1 UTSW 19 4105253 missense probably damaging 1.00
R2393:Pitpnm1 UTSW 19 4110935 missense probably benign 0.02
R3434:Pitpnm1 UTSW 19 4112234 missense probably damaging 1.00
R3439:Pitpnm1 UTSW 19 4112752 missense probably benign 0.00
R4554:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4555:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4557:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4831:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R4874:Pitpnm1 UTSW 19 4112252 critical splice donor site probably null
R5058:Pitpnm1 UTSW 19 4112758 missense probably benign 0.00
R5069:Pitpnm1 UTSW 19 4111140 missense probably benign 0.44
R5249:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R5288:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5385:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5619:Pitpnm1 UTSW 19 4103270 missense probably damaging 1.00
R5650:Pitpnm1 UTSW 19 4103319 missense possibly damaging 0.78
R6341:Pitpnm1 UTSW 19 4102829 nonsense probably null
R6608:Pitpnm1 UTSW 19 4110875 missense probably damaging 1.00
R6739:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6915:Pitpnm1 UTSW 19 4106947 missense possibly damaging 0.95
R7141:Pitpnm1 UTSW 19 4102787 missense probably damaging 0.97
R7751:Pitpnm1 UTSW 19 4103470 missense probably benign 0.02
R8057:Pitpnm1 UTSW 19 4112145 missense probably null 0.71
R8210:Pitpnm1 UTSW 19 4112878 critical splice donor site probably null
R8415:Pitpnm1 UTSW 19 4105454 missense probably benign 0.37
Z1177:Pitpnm1 UTSW 19 4105009 missense probably benign
Z1177:Pitpnm1 UTSW 19 4109996 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTCTCTGCCCTGGAAGTC -3'
(R):5'- TCCATCTACCTAGGACAATGTGTG -3'

Sequencing Primer
(F):5'- GGAAGTCTTCAGCTTCAGCC -3'
(R):5'- CTTATGAAGTGATACGCTTCCAGGC -3'
Posted On2018-03-15