Incidental Mutation 'R6268:Doxl2'
ID507150
Institutional Source Beutler Lab
Gene Symbol Doxl2
Ensembl Gene ENSMUSG00000068536
Gene Namediamine oxidase-like protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6268 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48974963-48978746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48977682 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 585 (Y585N)
Ref Sequence ENSEMBL: ENSMUSP00000139012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090063] [ENSMUST00000184917]
Predicted Effect probably benign
Transcript: ENSMUST00000090063
AA Change: Y585N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000087517
Gene: ENSMUSG00000068536
AA Change: Y585N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.5e-16 PFAM
Pfam:Cu_amine_oxid 298 708 1.3e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184852
SMART Domains Protein: ENSMUSP00000139236
Gene: ENSMUSG00000068536

DomainStartEndE-ValueType
Pfam:Cu_amine_oxid 15 212 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184917
AA Change: Y585N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139012
Gene: ENSMUSG00000068536
AA Change: Y585N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.1e-21 PFAM
Pfam:Cu_amine_oxidN3 146 246 3.1e-14 PFAM
Pfam:Cu_amine_oxid 298 711 1.4e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204745
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
Afg3l1 A T 8: 123,492,926 I398F probably damaging Het
Ahctf1 T C 1: 179,763,483 H1244R probably benign Het
Ank1 A T 8: 23,109,671 K797N probably damaging Het
Anxa6 G T 11: 54,987,077 probably null Het
Ap1b1 T A 11: 5,019,493 V310E probably damaging Het
C2cd2l T C 9: 44,317,666 I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cfap54 T A 10: 93,038,909 I542F probably damaging Het
Cfap57 G T 4: 118,569,451 Y1100* probably null Het
Coq9 A G 8: 94,850,234 E158G probably benign Het
Cox15 A T 19: 43,739,926 W303R possibly damaging Het
Cpa5 A G 6: 30,615,173 Y103C probably damaging Het
Crygn A T 5: 24,756,191 V39E probably damaging Het
Csf1 G T 3: 107,747,157 S132R possibly damaging Het
Dapk1 G A 13: 60,761,766 V1398M possibly damaging Het
Degs2 C A 12: 108,692,580 V47L probably damaging Het
Dock5 C A 14: 67,790,275 E1057* probably null Het
Dsg1b C A 18: 20,388,163 Q26K probably benign Het
Fam181a T C 12: 103,316,544 V236A possibly damaging Het
Fam78b C A 1: 167,078,553 P94T probably damaging Het
Fbxw25 T G 9: 109,654,650 T165P probably damaging Het
Flg C A 3: 93,288,175 probably benign Het
Frrs1 G T 3: 116,903,099 V573F probably damaging Het
Gm7298 A G 6: 121,779,073 T964A possibly damaging Het
Hoxd9 G T 2: 74,698,089 V12L probably damaging Het
Ikbkap T C 4: 56,762,305 Y1098C probably damaging Het
Kcnt1 A G 2: 25,903,597 probably null Het
Klhl3 G T 13: 58,013,842 R480S probably damaging Het
Klhl36 A G 8: 119,870,667 D369G probably damaging Het
Lama3 T A 18: 12,524,737 N303K probably damaging Het
Lhcgr T C 17: 88,742,704 T465A probably damaging Het
Llgl1 T C 11: 60,712,163 V888A probably benign Het
Lrp1b T A 2: 40,821,717 T3164S probably benign Het
Mmp3 T G 9: 7,447,622 D202E possibly damaging Het
Mocs1 C A 17: 49,435,155 T104K probably damaging Het
Mrpl42 A T 10: 95,496,707 probably null Het
Mtch2 T C 2: 90,863,648 C279R probably benign Het
Muc4 A T 16: 32,768,767 D2836V probably damaging Het
Myh7 T C 14: 54,989,284 E370G probably benign Het
Naa11 A G 5: 97,392,210 Y30H probably damaging Het
Ntng1 T C 3: 109,935,035 T141A probably damaging Het
Olfr1499 A T 19: 13,815,307 Y94* probably null Het
Olfr196 A C 16: 59,167,293 probably null Het
Olfr251 T C 9: 38,378,088 I69T probably benign Het
Pcdha12 G A 18: 37,022,424 C732Y possibly damaging Het
Plekhm2 G A 4: 141,632,341 Q392* probably null Het
Prr22 G A 17: 56,771,587 V247M probably damaging Het
Rapgef6 T A 11: 54,649,247 L716Q probably damaging Het
Rasgrp4 G A 7: 29,143,068 V246I probably damaging Het
Rhbdd2 C T 5: 135,643,260 T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Scgb2b20 A T 7: 33,364,548 I99K possibly damaging Het
Scyl3 C T 1: 163,946,217 R324* probably null Het
Slc23a1 T C 18: 35,619,571 Y551C probably damaging Het
Slc5a5 A T 8: 70,888,620 S358R probably damaging Het
Sorcs3 T A 19: 48,790,166 N1007K probably damaging Het
Stxbp4 T A 11: 90,540,201 K428* probably null Het
Tmem63c T A 12: 87,081,953 I584N probably damaging Het
Traf3ip3 C T 1: 193,198,036 probably benign Het
Trgv2 G A 13: 19,336,831 T31I probably benign Het
Ttll3 C T 6: 113,392,563 R23C probably benign Het
Ugt2a3 A C 5: 87,329,613 L309R probably damaging Het
Urb1 A G 16: 90,753,919 M2015T probably benign Het
Vmn2r14 A C 5: 109,221,417 S97A possibly damaging Het
Vps13c C A 9: 67,951,449 T2727K probably benign Het
Xrn1 T A 9: 95,964,014 I40K probably damaging Het
Zc3h11a A G 1: 133,624,557 V604A probably benign Het
Zfp410 G A 12: 84,331,838 R259H probably benign Het
Zfp748 A G 13: 67,542,586 V185A possibly damaging Het
Other mutations in Doxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Doxl2 APN 6 48978131 missense possibly damaging 0.82
IGL00985:Doxl2 APN 6 48977547 missense probably benign
IGL01556:Doxl2 APN 6 48975684 missense possibly damaging 0.58
IGL02083:Doxl2 APN 6 48976260 missense probably damaging 1.00
IGL02135:Doxl2 APN 6 48975564 missense probably benign 0.11
IGL02744:Doxl2 APN 6 48975315 missense probably benign 0.15
IGL03005:Doxl2 APN 6 48976546 nonsense probably null
R0306:Doxl2 UTSW 6 48976086 missense probably damaging 1.00
R0380:Doxl2 UTSW 6 48975839 missense probably benign
R0598:Doxl2 UTSW 6 48975537 missense probably benign 0.36
R0948:Doxl2 UTSW 6 48976344 missense probably damaging 1.00
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1432:Doxl2 UTSW 6 48975654 missense probably damaging 1.00
R1443:Doxl2 UTSW 6 48975915 missense probably damaging 1.00
R1535:Doxl2 UTSW 6 48975464 missense probably damaging 0.98
R1625:Doxl2 UTSW 6 48975171 missense probably damaging 1.00
R1872:Doxl2 UTSW 6 48975620 missense probably benign 0.00
R1960:Doxl2 UTSW 6 48975753 missense probably damaging 1.00
R2031:Doxl2 UTSW 6 48975855 missense probably damaging 0.99
R2049:Doxl2 UTSW 6 48977755 nonsense probably null
R2086:Doxl2 UTSW 6 48977602 missense probably damaging 1.00
R2144:Doxl2 UTSW 6 48975291 missense probably benign 0.00
R2145:Doxl2 UTSW 6 48976695 missense probably damaging 1.00
R2152:Doxl2 UTSW 6 48976539 missense probably damaging 1.00
R2255:Doxl2 UTSW 6 48975957 missense possibly damaging 0.75
R2973:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R2974:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R3125:Doxl2 UTSW 6 48975371 missense probably damaging 1.00
R4321:Doxl2 UTSW 6 48976522 missense probably damaging 1.00
R4367:Doxl2 UTSW 6 48976130 missense probably damaging 1.00
R4532:Doxl2 UTSW 6 48978167 missense possibly damaging 0.77
R4575:Doxl2 UTSW 6 48977568 nonsense probably null
R4611:Doxl2 UTSW 6 48975156 missense probably benign 0.39
R4823:Doxl2 UTSW 6 48975261 missense probably damaging 1.00
R5320:Doxl2 UTSW 6 48975540 missense probably damaging 1.00
R5520:Doxl2 UTSW 6 48975794 missense possibly damaging 0.93
R5698:Doxl2 UTSW 6 48976322 missense possibly damaging 0.94
R5765:Doxl2 UTSW 6 48978537 missense probably damaging 1.00
R6024:Doxl2 UTSW 6 48976096 missense possibly damaging 0.71
R6061:Doxl2 UTSW 6 48976601 missense probably benign 0.02
R6564:Doxl2 UTSW 6 48977575 missense probably benign 0.00
R6640:Doxl2 UTSW 6 48977671 missense probably benign 0.21
R7131:Doxl2 UTSW 6 48976372 nonsense probably null
X0013:Doxl2 UTSW 6 48977613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGTTCCAGGCACCAACAAC -3'
(R):5'- GGGCATGAGGATGTACACTCAG -3'

Sequencing Primer
(F):5'- CAGCTTCCACACACTGCAGG -3'
(R):5'- GACTCACACATGGACTCAGAGTGTC -3'
Posted On2018-03-15