Incidental Mutation 'R6268:Ttll3'
ID 507151
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms 4833441J24Rik
MMRRC Submission 044439-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6268 (G1)
Quality Score 121.008
Status Validated
Chromosome 6
Chromosomal Location 113366221-113391548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113369524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 23 (R23C)
Ref Sequence ENSEMBL: ENSMUSP00000037870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000203578] [ENSMUST00000204802] [ENSMUST00000205017] [ENSMUST00000204026]
AlphaFold A4Q9E5
Predicted Effect probably benign
Transcript: ENSMUST00000032414
AA Change: R23C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: R23C

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
AA Change: R23C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: R23C

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156898
SMART Domains Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 167 8.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171058
SMART Domains Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 91 1.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203524
Predicted Effect probably benign
Transcript: ENSMUST00000203578
SMART Domains Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204802
SMART Domains Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Predicted Effect probably benign
Transcript: ENSMUST00000204026
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204683
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,545,219 (GRCm39) I78T probably benign Het
Afg3l1 A T 8: 124,219,665 (GRCm39) I398F probably damaging Het
Ahctf1 T C 1: 179,591,048 (GRCm39) H1244R probably benign Het
Ank1 A T 8: 23,599,687 (GRCm39) K797N probably damaging Het
Anxa6 G T 11: 54,877,903 (GRCm39) probably null Het
Aoc1l1 T A 6: 48,954,616 (GRCm39) Y585N probably benign Het
Ap1b1 T A 11: 4,969,493 (GRCm39) V310E probably damaging Het
C2cd2l T C 9: 44,228,963 (GRCm39) I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,579,599 (GRCm39) probably null Het
Cfap54 T A 10: 92,874,771 (GRCm39) I542F probably damaging Het
Cfap57 G T 4: 118,426,648 (GRCm39) Y1100* probably null Het
Coq9 A G 8: 95,576,862 (GRCm39) E158G probably benign Het
Cox15 A T 19: 43,728,365 (GRCm39) W303R possibly damaging Het
Cpa5 A G 6: 30,615,172 (GRCm39) Y103C probably damaging Het
Crygn A T 5: 24,961,189 (GRCm39) V39E probably damaging Het
Csf1 G T 3: 107,654,473 (GRCm39) S132R possibly damaging Het
Dapk1 G A 13: 60,909,580 (GRCm39) V1398M possibly damaging Het
Degs2 C A 12: 108,658,839 (GRCm39) V47L probably damaging Het
Dock5 C A 14: 68,027,724 (GRCm39) E1057* probably null Het
Dsg1b C A 18: 20,521,220 (GRCm39) Q26K probably benign Het
Elp1 T C 4: 56,762,305 (GRCm39) Y1098C probably damaging Het
Fam181a T C 12: 103,282,803 (GRCm39) V236A possibly damaging Het
Fam78b C A 1: 166,906,122 (GRCm39) P94T probably damaging Het
Fbxw25 T G 9: 109,483,718 (GRCm39) T165P probably damaging Het
Flg C A 3: 93,195,482 (GRCm39) probably benign Het
Frrs1 G T 3: 116,696,748 (GRCm39) V573F probably damaging Het
Gm7298 A G 6: 121,756,032 (GRCm39) T964A possibly damaging Het
Hoxd9 G T 2: 74,528,433 (GRCm39) V12L probably damaging Het
Kcnt1 A G 2: 25,793,609 (GRCm39) probably null Het
Klhl3 G T 13: 58,161,656 (GRCm39) R480S probably damaging Het
Klhl36 A G 8: 120,597,406 (GRCm39) D369G probably damaging Het
Lama3 T A 18: 12,657,794 (GRCm39) N303K probably damaging Het
Lhcgr T C 17: 89,050,132 (GRCm39) T465A probably damaging Het
Llgl1 T C 11: 60,602,989 (GRCm39) V888A probably benign Het
Lrp1b T A 2: 40,711,729 (GRCm39) T3164S probably benign Het
Mmp3 T G 9: 7,447,622 (GRCm39) D202E possibly damaging Het
Mocs1 C A 17: 49,742,183 (GRCm39) T104K probably damaging Het
Mrpl42 A T 10: 95,332,569 (GRCm39) probably null Het
Mtch2 T C 2: 90,693,992 (GRCm39) C279R probably benign Het
Muc4 A T 16: 32,589,141 (GRCm39) D2836V probably damaging Het
Myh7 T C 14: 55,226,741 (GRCm39) E370G probably benign Het
Naa11 A G 5: 97,540,069 (GRCm39) Y30H probably damaging Het
Ntng1 T C 3: 109,842,351 (GRCm39) T141A probably damaging Het
Or5h26 A C 16: 58,987,656 (GRCm39) probably null Het
Or8c11 T C 9: 38,289,384 (GRCm39) I69T probably benign Het
Or9i14 A T 19: 13,792,671 (GRCm39) Y94* probably null Het
Pcdha12 G A 18: 37,155,477 (GRCm39) C732Y possibly damaging Het
Plekhm2 G A 4: 141,359,652 (GRCm39) Q392* probably null Het
Prr22 G A 17: 57,078,587 (GRCm39) V247M probably damaging Het
Rapgef6 T A 11: 54,540,073 (GRCm39) L716Q probably damaging Het
Rasgrp4 G A 7: 28,842,493 (GRCm39) V246I probably damaging Het
Rhbdd2 C T 5: 135,672,114 (GRCm39) T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Scgb2b20 A T 7: 33,063,973 (GRCm39) I99K possibly damaging Het
Scyl3 C T 1: 163,773,786 (GRCm39) R324* probably null Het
Slc23a1 T C 18: 35,752,624 (GRCm39) Y551C probably damaging Het
Slc5a5 A T 8: 71,341,264 (GRCm39) S358R probably damaging Het
Sorcs3 T A 19: 48,778,605 (GRCm39) N1007K probably damaging Het
Stxbp4 T A 11: 90,431,027 (GRCm39) K428* probably null Het
Tmem63c T A 12: 87,128,727 (GRCm39) I584N probably damaging Het
Traf3ip3 C T 1: 192,880,344 (GRCm39) probably benign Het
Trgv2 G A 13: 19,521,001 (GRCm39) T31I probably benign Het
Ugt2a3 A C 5: 87,477,472 (GRCm39) L309R probably damaging Het
Urb1 A G 16: 90,550,807 (GRCm39) M2015T probably benign Het
Vmn2r14 A C 5: 109,369,283 (GRCm39) S97A possibly damaging Het
Vps13c C A 9: 67,858,731 (GRCm39) T2727K probably benign Het
Xrn1 T A 9: 95,846,067 (GRCm39) I40K probably damaging Het
Zc3h11a A G 1: 133,552,295 (GRCm39) V604A probably benign Het
Zfp410 G A 12: 84,378,612 (GRCm39) R259H probably benign Het
Zfp748 A G 13: 67,690,705 (GRCm39) V185A possibly damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113,371,690 (GRCm39) missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113,389,945 (GRCm39) missense probably benign
IGL01697:Ttll3 APN 6 113,376,690 (GRCm39) missense probably benign 0.00
IGL01944:Ttll3 APN 6 113,391,076 (GRCm39) missense probably benign
IGL02688:Ttll3 APN 6 113,376,700 (GRCm39) missense probably benign 0.00
IGL03068:Ttll3 APN 6 113,386,158 (GRCm39) missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113,375,738 (GRCm39) missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113,386,300 (GRCm39) missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113,385,864 (GRCm39) critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113,369,725 (GRCm39) missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113,375,731 (GRCm39) missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113,386,003 (GRCm39) missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113,389,895 (GRCm39) missense probably benign 0.31
R2896:Ttll3 UTSW 6 113,369,683 (GRCm39) missense probably benign 0.15
R2903:Ttll3 UTSW 6 113,384,284 (GRCm39) missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113,369,471 (GRCm39) unclassified probably benign
R4659:Ttll3 UTSW 6 113,391,102 (GRCm39) missense probably benign
R4746:Ttll3 UTSW 6 113,384,353 (GRCm39) missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113,389,901 (GRCm39) missense probably benign 0.00
R5358:Ttll3 UTSW 6 113,378,292 (GRCm39) missense probably benign 0.26
R5372:Ttll3 UTSW 6 113,378,382 (GRCm39) nonsense probably null
R5525:Ttll3 UTSW 6 113,389,939 (GRCm39) missense probably benign
R5548:Ttll3 UTSW 6 113,370,078 (GRCm39) missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113,376,669 (GRCm39) missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113,374,992 (GRCm39) nonsense probably null
R6119:Ttll3 UTSW 6 113,371,702 (GRCm39) missense probably damaging 1.00
R6719:Ttll3 UTSW 6 113,375,993 (GRCm39) intron probably benign
R6852:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R6852:Ttll3 UTSW 6 113,376,116 (GRCm39) frame shift probably null
R6852:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R6853:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R6854:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7170:Ttll3 UTSW 6 113,390,839 (GRCm39) missense probably benign 0.41
R7239:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7302:Ttll3 UTSW 6 113,386,246 (GRCm39) missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113,376,125 (GRCm39) frame shift probably null
R7330:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7586:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7587:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7701:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7702:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7776:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7793:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7797:Ttll3 UTSW 6 113,371,738 (GRCm39) missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7825:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7825:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7826:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7827:Ttll3 UTSW 6 113,376,123 (GRCm39) frame shift probably null
R7827:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7831:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7832:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7833:Ttll3 UTSW 6 113,386,298 (GRCm39) missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R8344:Ttll3 UTSW 6 113,371,959 (GRCm39) missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113,371,734 (GRCm39) missense probably benign 0.04
R8768:Ttll3 UTSW 6 113,385,949 (GRCm39) missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113,389,850 (GRCm39) missense probably benign 0.00
R9036:Ttll3 UTSW 6 113,376,657 (GRCm39) missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113,369,596 (GRCm39) missense probably benign
R9271:Ttll3 UTSW 6 113,369,596 (GRCm39) missense probably benign
R9329:Ttll3 UTSW 6 113,369,635 (GRCm39) missense probably benign
R9532:Ttll3 UTSW 6 113,385,970 (GRCm39) missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113,389,834 (GRCm39) missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113,386,114 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCGACTTCCCTAAGGCCAC -3'
(R):5'- GCAATGAGCTGTAATCCCGAC -3'

Sequencing Primer
(F):5'- GCCTCCACAGAGTCTGATTGTG -3'
(R):5'- TGTAATCCCGACGGCTGTC -3'
Posted On 2018-03-15